Cell culture<\/p>\n
Cells were grown in complete DMEM medium (D5796, containing 4,500\u2009mg\u2009l\u22121 glucose, 2\u2009mM L-glutamine) supplemented with dialysed 10% FBS (Sigma-Aldrich, F7524), 1% penicillin\u2013streptomycin (PenStrep, Lonza), at 37\u2009\u00b0C in an atmosphere of 5% CO2 and 95% air. Where indicated, 50\u2009\u03bcg\u2009ml\u22121 uridine and\/or 1\u2009mM sodium pyruvate (Sigma-Aldrich) were added to the growing media. Inhibitors were purchased from Sigma-Aldrich and used as follows: brequinar (2\u2009\u03bcM); antimycin A and myxothiazol (20\u2009\u03bcM each); and chloramphenicol (40\u2009\u03bcg\u2009ml\u22121). Cells were pre-treated with chloramphenicol for 1\u2009week in the presence of uridine to deplete them of respiratory complexes48<\/a>. Control cells were treated with the appropriate vehicle (ethanol or dimethylsulfoxide (DMSO)). The origin of cell lines was: \u03c10 cells49<\/a>, Mt-Cybmut and Cox10KO AOX-expressing cells29<\/a>.<\/p>\n Generation of ScURA-expressing cells<\/p>\n The coding sequence of ScURA was obtained from a previous publication50<\/a> and modified as follows. A myc tag was added at the C terminus through a (GGS)3 linker, and at both ends, restriction enzyme sites were inserted. Codon-optimization and oligonucleotide synthesis were performed by Genewiz. The gene was cloned into the pWXLd lentiviral vector (modified from Trono\u2019s lab with a puromycin resistance gene, Addgene). Lentivirus production was carried out by the Viral Vector unit at Centro Nacional de Investigaciones Cardiovasculares (CNIC). Viral supernatants were filtered and added to cells with 8\u2009\u03bcg\u2009ml\u22121 polybrene overnight. Then, 2\u2009days after transduction, ScURA-expressing cells were selected with puromycin 0.5\u2009\u03bcg\u2009ml\u22121 for approximately 1\u2009week until non-transduced cells in a control plate were dead. For each cell line, a cell line transduced with an empty vector was used as a control.<\/p>\n Growth curve and cell doubling time<\/p>\n On day\u20090, a total of 40,000\u2009cells were plated into six-well plates. For each condition, three wells were incubated for 6\u2009h (to allow the cells adhere to the plate), collected and counted. This count was recorded as the number of cells at day\u20090. For 3\u20134\u2009days, fresh media and the appropriate treatments were added to each well every day. On the last day, three wells per condition were collected and counted. The number of doublings pre day was calculated as 24\u2009\/\u2009((T\u2009\u00d7\u2009(ln2))\u2009\/\u2009(ln(nf\u2009\/\u2009n0))), where T is time in hours, nf is the number of cells on the final day and n0 is the number of cells at day\u20090.<\/p>\n Whole-cell homogenate and mitochondria isolation<\/p>\n Cells from two to ten 150\u2009mm plates were collected with trypsin, washed in PBS and resuspended in cold sucrose buffer (0.32\u2009M sucrose, 1\u2009mM EDTA, 10\u2009mM Tris-HCl pH\u20097.4). Cells were then homogenized in a Teflon potter-type tissue homogenizer with 20\u201340 \u2018pops\u2019. The homogenate was centrifuged at 1,000g for 5\u2009min, the nuclear pellet was discarded and the post-nuclear whole-cell homogenate was stored at \u221280\u2009\u00b0C. When mitochondria were isolated, the whole-cell homogenate obtained was further centrifuged at 10,000g for 10\u2009min. The pellet obtained was resuspended in sucrose buffer and stored at \u221280\u2009\u00b0C.<\/p>\n Spectrophotometric DHODH activity<\/p>\n DHODH activity was measured following a previously published method51<\/a>, with some modifications: 100\u2009\u00b5g of whole-cell homogenates were used for each reaction in a final volume of 200\u2009\u00b5l. Each biological replicate was split into three technical replicates. DHODH-dependent reduction of 2,6-dichloroindophenol (DCPIP) was measured with a UV-visible spectrophotometer equipped with a 96-well plate reader. Samples were resuspended in reaction buffer (50\u2009mM Tris-HCl, 150\u2009mM KCl, 3\u2009mM KCN, 0.05\u2009mM DCPIP, 0.25\u2009mM decylubiquinone, pH\u20097.5) and incubated for 2\u2009min at 37\u2009\u00b0C. The reaction was started by the addition of 1\u2009mM DHO. The first 3\u2009min of the reaction were linear and were used for the analysis. The rate of background (DHODH-independent) DCPIP reduction was measured in parallel by omitting DHO from the reaction mixture and was subtracted from the DHO-dependent rate for each sample. Brequinar was added where indicated at 0.05\u2009mM; controls were treated with the same volume of DMSO.<\/p>\n Gel electrophoresis<\/p>\n All gels were prepared in-house with Tris-HCl buffer and acrylamide\/bis. Protein samples were quantified and loaded on the gel, and electrophoresis was performed in Tris-glycine solution. For denaturing electrophoresis, 0.1% SDS was added to the gels and protein samples were incubated for 1\u2009min at 95\u2009\u00b0C in loading buffer (50\u2009mM Tris-HCl, pH\u20096.8, 2% SDS, 10% glycerol, 1% \u03b2-mercaptoethanol, 0.02% bromophenol blue) before loading. For non-denaturing native gels, SDS was not added to the gel, whole-cell homogenates were not boiled and the loading buffer used did not contain SDS or \u03b2-mercaptoethanol.<\/p>\n Immunoblotting<\/p>\n Proteins were transferred to PVDF membrane (Immobilon-FL, 0.45\u2009\u03bcm) by transfer in BioRad Mini Trans-Blot Cell or Trans-Blot Cell systems, in 48\u2009mM Tris, 39\u2009mM glycine and 20% methanol transfer solution overnight at 30\u2009V. The membrane was then blocked in 0.1% PBS-Tween, 5% BSA solution for 1\u2009h at room temperature (22 \u00b0C) and incubated with primary antibody overnight at 4\u2009\u00b0C. After that, the membrane was incubated with secondary antibody for 1\u2009h at room temperature. Membrane development was performed using fluorescent secondary antibody and revealed with the Odyssey imaging system (LI-COR Biosciences). Antibodies used included anti-hemoagglutinin-tag (1:5,000; Sigma-Aldrich, sAB 4300603), anti-betaActin (1:10,000; Sigma-Aldrich, A2066), anti-GAPDH (1:5,000; Abcam, AB8245) and anti-SDHA (1:5,000; Invitrogen, 459200 or Proteintech, 14865-1-AP).<\/p>\n Blue native\u2013PAGE and complex I in-gel activity<\/p>\n The procedure was carried out as detailed previously48<\/a>. In brief, 100\u2009\u03bcg of mitochondria were incubated with 400\u2009\u03bcg of digitonin for 5\u2009min in 50\u2009mM NaCl buffer, 50\u2009mM imidazole, 5\u2009mM aminocaproic acid at a final concentration of 10\u2009\u03bcg\u2009\u03bcl\u22121. Electrophoresis was performed in a cold chamber and developed for 30\u2009min at 90\u2009V with cathode buffer A. Then, the cathode buffer was exchanged for cathode buffer B, and electrophoresis continued for approximately 1\u2009h more at 300\u2009V. Measurement of NADH dehydrogenase activity of complex I was determined on the same gel after blue native\u2013PAGE electrophoresis by incubating the gel in 0.1\u2009M Tris-HCl, pH\u20097.4, 0.14\u2009mM NADH and 1\u2009mg\u2009ml\u22121 NitroBlue tetrazolium solution at room temperature.<\/p>\n ATP synthesis<\/p>\n ATP synthesis was assessed as previously described52<\/a>. In brief, 1.5\u2009billion cells were permeabilized with digitonin and ATP synthesis was assayed using glutamate plus malate or succinate as fuels in the presence of adenosine 5\u2032-diphosphate and diadenosine pentaphosphate (to inhibit the adenylyl kinase) by a kinetic luminescence assay using the luciferin\u2013luciferase reaction.<\/p>\n Oxygen consumption rate<\/p>\n A total of 10,000 cells were plated in a Seahorse XF96 microplate the day before the assay. Cells were washed in MAS medium (70\u2009mM sucrose, 220\u2009mM mannitol, 5\u2009mM KH2PO4, 5\u2009mM MgCl2, 1\u2009mM EGTA, 2\u2009mM HEPES pH\u20097.4) containing 0.2% w\/v free fatty acid BSA and then placed in MAS media containing ADP and digitonin (4\u2009mM and 10\u2009\u00b5g\u2009ml\u22121 final concentrations, respectively), incubated for 3\u2009min at 37\u2009\u00b0C and then loaded in the instrument. Substrate injection was as follows: glutamate\u2009+\u2009malate (5\u2009mM each, port A); rotenone (2\u2009\u00b5M, port B); succinate (5\u2009mM, port C); antimycin A (1\u2009\u00b5M, port D). These conditions allow for the determination of the respiratory capacity of mitochondria through complex I and complex II. For measuring activities of mitochondrial complexes, frozen\u2013thawed cells were used as previously detailed53<\/a>.<\/p>\n Phylogenetic tree construction<\/p>\n The amino acid sequence of DHODH from various species was retrieved from UniProt. The R packages msa54<\/a>, ape55<\/a> and ggmsa56<\/a> were used for multiple sequence alignment, phylogenetic tree construction and generation.<\/p>\n Immunocytochemistry<\/p>\n In total, 20,000 cells were seeded per well on a 12-well plate containing previously sterilized precision cover glasses (Marienfeld, 0117520) and left incubating at 37\u2009\u00b0C and 5% CO2 in their corresponding medium. After 48\u2009h, cells were fixed for 15\u2009min at 37\u2009\u00b0C in pre-warmed 4% paraformaldehyde (ThermoFisher, 043368.9M) diluted in 1\u00d7 PBS, followed by three washes in 1\u00d7 PBS. Fixed cells were permeabilized with 0.1% Triton-X100 in 1\u00d7 PBS for 10\u2009min at room temperature. Cells were blocked in 2% BSA (w\/v) in 1\u00d7 PBS, then incubated with a Tomm20-CL488 antibody (1:500) (Proteintech, 30235116) diluted in blocking buffer. Cells were then incubated in Alexa Fluor 405 N-hydroxysuccinimide (NHS) ester (1:5,000) (ThermoFisher, A30000) diluted in 1\u00d7 PBS. All incubation steps were performed for 40\u2009min at room temperature and followed by three 5\u2009min washes in 1\u00d7 PBS-Tween 0.1%. Samples were finally mounted on microscopy slides using ProLong Gold Antifade Reagent (Invitrogen, P36934).<\/p>\n Microscopy image acquisition<\/p>\n All microscopy images were collected on a Leica SP5 inverted confocal microscope equipped with a HCX PL APO \u03bb blue \u00d763, 1.40\u2009NA oil objective. Z-stacks containing 10 planes (with a step size of 0.34\u2009\u00b5m) were acquired in a sequential line scanning mode using LAS-AF (v.2.6.0) software (Leica Microsystems) at a digital zoom of \u00d72, pixel size of 60\u2009nm, scanner speed of 200\u2009Hz and 3 line averages, with a pinhole size of 1\u2009AU. The Tomm20 signal was excited using the Argon 488 laser line at 10% intensity, and the corresponding 505\u2013555\u2009nm emission was collected using a PMT detector set at 800\u2009V gain and \u22120.1% offset. The NHS405 signal was excited using the UV diode 405 laser line at 2% intensity, and 420\u2013485\u2009nm emission was collected using a PMT detector at 900\u2009V gain and \u22121% offset.<\/p>\n Microscopy image analysis<\/p>\n Image analysis was mainly performed in FIJI 1.53t. Z-stacks were first projected into a single plane using the maximum intensity method. For mitochondria, the signal of Ch2 (NHS405) was subtracted to that of Ch1 (Tomm20-CL488) and the resulting image was then thresholded with the Mitochondria Analyzer plugin57<\/a> using the following parameters: remove particles (size, \u22640.1\u2009\u00b5m2), subtract background (rolling, 2.0), sigma filter plus (radius, 2.0), enhance local contrast (max slope, 3.0), weighted mean threshold (block size, 1.45; C-value, 5.0) and despeckle and remove outliers (pixels, 4.0). Individual networks were isolated from whole thresholded images, and morphology parameters of mitochondria were calculated on a per-cell basis. For analysis of cell morphology, the NHS405 channel was first pre-processed in FIJI by applying CLAHE (block, 500; bin, 256; slope, 10) and a Gaussian blur (radius, 0.3\u2009\u00b5m). The objects were then thresholded and their morphology analysed in Cellprofiler (v.4.2.8)58<\/a> using an adaptive Otsu method with three classes.<\/p>\n CRISPR\u2013CAS9-mediated generation of SDHAKO cell lines<\/p>\n U2OS (ATCC, HTB-96) and 143B (ATCC, CRL-8303) SDHAKO clonal cell lines were generated through nucleofection (Neon transfection system, Invitrogen) of ribonucleoprotein complexes prepared by incubating 2\u2009\u00b5g of TrueCut Cas9 Protein v2 (Invitrogen, A36499) and 2\u2009\u00b5g of a pair of single guide RNAs (sgRNAs) (sgRNA 1 target sequence at intron 1, AACCCTGAAGGCAGCCCAAG; sgRNA 2 target sequence at exon 4, GGGCCTGCTCCGTCATGTAG). DNA oligonucleotides used for sgRNA synthesis were designed using the CRISPOR algorithm (http:\/\/crispor.tefor.net<\/a>), and sgRNAs were synthesized using the GeneArt Precision gRNA Synthesis Kit (Invitrogen, A29377). Nucleofection was carried out at 1230\u2009V or 1300\u2009V (four pulses of 10\u2009ms) for U2OS or 143B cells, respectively. Following nucleofection, cells were seeded into six-well plates and allowed to recover for 48\u2009h. For single-cell clone isolation, cells were sorted using a spectral cell sorter (Cytek Aurora CS). Genomic DNA was extracted, and a pair of primers (primer 1A, GAGTGTGCATCCGACATCCTC; primer 2A, CTCATCACCATTCTTTTGGCTG) flanking SDHA-targeted regions was used to perform PCR screening. Clones were considered positive for gene editing when the amplified product was 551\u2009bp, indicating deletion of the whole DNA fragment between targeted regions. The absence of SDHA protein was confirmed by western blot against SDHA (Santa Cruz, sc-166909), performed following separation of total cell protein extracts on 10% SDS\u2013PAGE gels. Positive clones were further validated by Sanger sequencing of the SDHA gene.<\/p>\n CRISPR\u2013CAS9-mediated generation of DHODHKO cell line<\/p>\n A clonal 143B-DHODHKO cell line was generated by following a previously published protocol59<\/a>, with slight modifications. Each pair of gene-specific sgRNAs (pair 1, CCGCGGAGGACTACGCAGAA; pair 2, ATAGAAACGCTCATCTCCCG) targeting different regions of the gene was cloned into a TCLV2 plasmid (Addgene, 87360)60<\/a>. Lentiviral particles were made in the Viral Vectors Unit at CNIC. All 143B cells were seeded on six-well plates, and at 80% confluency, they were transduced with lentiviral particles in DMEM supplemented with only 2% FBS, which was changed the following day for fresh complete medium. After 48\u2009h, infected cells were selected by treatment with 1\u2009\u00b5g\u2009ml\u22121 puromycin in complete DMEM. After 48\u2009h, surviving cells were treated with 2\u2009\u00b5g\u2009ml\u22121 doxycycline to induce Cas9-2A-eGFP expression and were then sorted into a 96-well plate at one cell per well using a FACSAria cell sorter. Final clones were selected by observing cell death in medium lacking uridine and confirmed by running total cell protein extracts on a 12.5% SDS\u2013PAGE gel and performing a western blot against DHODH (1:1,000) (Santa Cruz, sc166348).<\/p>\n Re-expression of DHODH and ScURA in DHODHKO cell line<\/p>\n The 143B-DHODHKO cells were used to re-express a WT version of hDHODH, a version of the protein lacking the mitochondria peptide signal and the transmembrane alpha helix (hDHODH\u0394MTS) and codon-optimized ScURA protein fused to a c-Myc tag (ScURA-myc). The vectors used were constructed and packaged by VectorBuilder, and the lentiviral particles were generated by the Viral Vectors Unit at CNIC. 143B-DHODHKO cells were seeded on six-well plates, and at 80% confluency, they were transduced with lentiviral particles in DMEM supplemented with 2% FBS, which was changed the following day for fresh complete medium containing uridine. Infected cells were selected by treatment with 400\u2009\u00b5g\u2009ml\u22121 hygromycin B for at least 4\u2009days. Re-expression of the proteins was confirmed by running total cell protein extracts on a 12.5% SDS\u2013PAGE gel and performing a western blot against DHODH (1:1,000) (Santa Cruz, sc166348) and c-myc (1:5,000).<\/p>\n Metabolite extraction from cultured cells<\/p>\n For each condition, cells were seeded in six-well plates (with one plate kept aside for cell counting) in DMEM\u2009+\u200910% dialysed FBS, no uridine. The day after seeding, media containing inhibitors (1\u2009\u03bcM each antimycin and myxothiazol, 2\u2009\u03bcM brequinar) and radio-labelled tracers (2\u2009mM [\u03b1-15N]glutamine or [U-13C]glutamine; Cambridge Isotope Laboratories) were added. After 24\u2009h of incubation, metabolites were extracted in metabolite extraction buffer (50% methanol, 30% acetonitrile, 20% water (all liquid chromatography\u2013mass spectrometry grade), 5\u2009\u00b5M valine-d8, CK isotopes and DLM-488). Cells were washed with PBS, and 500\u2009\u03bcl of cold metabolite extraction buffer per million cells was added to the wells; the plate was then immediately placed at \u221280\u2009\u00b0C for 20\u2009min. The cell lysate\u2013extraction buffer solution mixture was shaken at maximum speed for 15\u2009min at 4\u2009\u00b0C, centrifuged at 13,000g for 30\u2009min at 4\u2009\u00b0C and the supernatant was collected in a HPLC vial. A pooled sample was prepared by taking 15\u2009\u03bcl from each individual sample.<\/p>\n Liquid chromatography\u2013mass spectrometry analysis<\/p>\n Metabolites were separated on a Millipore SeQuant ZIC-pHILIC analytical column (5\u2009\u00b5m, 2.1\u2009\u00d7\u2009150\u2009mm) coupled to a guard column (2.1\u2009\u00d7\u200920\u2009mm, 5\u2009\u00b5m). The mobile phase consisted of solvent A (20\u2009mM ammonium carbonate with 2.5\u2009\u00b5M medronic acid, adjusted to pH\u20099.7 with ammonium hydroxide) and solvent B (acetonitrile in water, 95:5, v\/v). The column oven was maintained at 40\u2009\u00b0C, and the autosampler was kept at 4\u2009\u00b0C. Chromatography was performed at a flow rate of 0.20\u2009ml\u2009min\u22121 with the following gradient programme: 0\u20132\u2009min, 85% B; 2\u201314\u2009min, linear decrease to 30% B; 14\u201315\u2009min, isocratic at 30% B; 15\u201317.1\u2009min, re-equilibration to 85% B; and 17.1\u201323\u2009min, hold at 85% B.<\/p>\n Metabolite quantification was performed on a Vanquish Horizon UHPLC system coupled to an Orbitrap Exploris 120\/240 mass spectrometer (Thermo Fisher Scientific) equipped with a heated electrospray ionization source. Ionization parameters were set to +3.5\u2009kV for positive mode and \u22122.8\u2009kV for negative mode, with an RF lens setting of 70, a heated capillary temperature of 320\u2009\u00b0C and an auxiliary gas heater temperature of 280\u2009\u00b0C. Sheath gas flow was set to 40, auxiliary gas to 15 and sweep gas was disabled. For MS1 acquisition, data were collected in full scan mode over a mass range of m\/z\u2009=\u200970\u2013900, using a standard automatic gain control target with an automatically determined maximum injection time. Data were acquired with polarity switching at an Orbitrap resolution of 120,000. Untargeted metabolite profiling was performed using the AcquireX Deep Scan workflow with iterative data-dependent acquisition on pooled samples. Full scans were acquired at a resolution of 60,000, with tandem mass spectrometry fragmentation at 30,000 resolution and a minimum intensity threshold of 5.0\u2009\u00d7\u2009103. Dynamic exclusion was triggered after a single event (10\u2009s, \u00b15\u2009ppm), and precursors were isolated with a 1.2\u2009m\/z window. Stepped higher-energy collisional dissociation energies of 30, 50 and 150 were applied, with mild trapping enabled to improve signal quality.<\/p>\n Metabolite identification was performed using Compound Discoverer (v.3.2; Thermo Fisher Scientific). Compounds were assigned based on precursor m\/z values within 5\u2009ppm of the theoretical mass, fragment ion matches within 5\u2009ppm to an internal spectral library of authentic standards analysed under identical data-dependent tandem mass spectrometry conditions (minimum match score of \u226570), and retention times within 5% of those of purified standards under the same chromatographic conditions. Peak area integration and chromatogram evaluation were carried out in TraceFinder (v.5.1; Thermo Fisher Scientific), and isotopologue distributions were corrected for natural isotope abundance using the AccuCor package61<\/a>.<\/p>\n Semi-targeted metabolomics data analysis<\/p>\n Features were filtered using the 80% modified rule62<\/a>, followed by exclusion of metabolites with a coefficient of variation of >30% in pooled quality control samples63<\/a>. These filtering steps retain stable metabolites consistently detected in the samples, thereby preserving only robust and reproducible features. Intensities were normalized to the valine-d8 internal standard to correct for sample-to-sample technical variations, followed by LOESS signal correction to account for a systematic run order-dependent drift. Missing values were imputed with the group mean, while features entirely absent in a group were substituted with half of the minimum detected intensity in the dataset. Subsequently, data were log2-transformed to stabilize variance and improve normality before statistical analysis. Principal component analysis was performed using the prcomp function from the R stats package64<\/a>, and Hotelling\u2019s T2 test was applied to identify sample outliers using the qcc package65<\/a>. Sample group differential abundance was assessed using two-sided Student\u2019s t-tests, and P\u2009values were adjusted for multiple testing using the Benjamini\u2013Hochberg method from the R base stats package. Finally, readxl66<\/a> and tidyverse were used for general scripting67<\/a>.<\/p>\n Transcriptomic analysis<\/p>\n RNA sequencing was performed by the CNIC Genomics Unit team. RNA libraries were produced using the Illumina TruSeq RNASeq kit and sequenced in an Illumina HiSeq 2500 Sequencer. Downstream analysis was performed using the nf-core\/rnaseq analysis pipeline68<\/a> using Nextflow (v.24.10.5). In brief, following quality control with FastQC, adaptor sequences were removed using Trim Galore! The cleaned reads were then aligned to the Homo sapiens reference genome (GRCh38, Ensembl release 104) using the STAR aligner. Transcript-level abundances were quantified with Salmon, and gene-level read counts were generated using featureCounts. Raw counts were normalized using the variance stabilizing transformation function, and differential gene expression analysis was performed within the DESeq2 package69<\/a>. P\u2009values were adjusted for multiple testing using the Benjamini\u2013Hochberg procedure. Pathway enrichment analysis was performed using clusterProfiler70<\/a> with statistics obtained from DESeq2. Transcription factor activity was inferred with decoupleR23<\/a> (univariate linear model), with DoRothEA regulons71<\/a>. We filtered for regulons with a high level of confidence (\u2018A\u2019). Generation of heatmaps and figures was done in R using the pheatmap package.<\/p>\n Statistics and reproducibility<\/p>\n Data are presented as mean\u2009\u00b1\u2009s.d. Statistical analyses were performed using GraphPad Prism 10. The statistical tests used, sample size and post hoc corrections are indicated in the figure legends. All statistical tests were two-tailed and had an alpha of 0.05 as the significance threshold. *P\u2009<\u20090.05. No data were excluded.<\/p>\n Reporting summary<\/p>\n