{"id":342091,"date":"2025-10-30T02:05:17","date_gmt":"2025-10-30T02:05:17","guid":{"rendered":"https:\/\/www.europesays.com\/us\/342091\/"},"modified":"2025-10-30T02:05:17","modified_gmt":"2025-10-30T02:05:17","slug":"evidence-for-improved-dna-repair-in-long-lived-bowhead-whale","status":"publish","type":"post","link":"https:\/\/www.europesays.com\/us\/342091\/","title":{"rendered":"Evidence for improved DNA repair in long-lived bowhead whale"},"content":{"rendered":"<p>Reagents<\/p>\n<p>Detailed information on reagents, such as antibodies and sequences of primers, probes, CRISPR guides, and siRNAs, is provided in Supplementary Table <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#MOESM1\" target=\"_blank\" rel=\"noopener\">2<\/a>.<\/p>\n<p>Animal experiments<\/p>\n<p>All animal experiments were approved and performed under pre-approved protocols and in accordance with guidelines set by the University of Rochester Committee on Animal Resources (UCAR).<\/p>\n<p>Whale sample collection<\/p>\n<p>Bowhead whale tissues were obtained from adult bowhead whales (B. mysticetus) captured during 2014 and 2018 I\u00f1upiaq subsistence harvests in Barrow (Utqia\u0121vik), Alaska, in collaboration with the North Slope Borough Department of Wildlife Management and Alaska Eskimo Whaling Commission after signing a Memorandum of Understanding (September 2014 and March 2021). Tissues were sampled immediately after bowhead whales were brought ashore, after permission to sample was given by the whaling captain, and explants kept in culture medium on ice or at 4\u2009\u00b0C through initial processing and shipping until arrival at the University of Rochester for primary fibroblast isolation from skin and lung. Transfer of bowhead whale samples from North Slope Borough Department of Wildlife Management to University of Rochester was under National Oceanic and Atmospheric Administration (NOAA)\/National Marine Fisheries Service permit 21386.<\/p>\n<p>Cells and tissues used in the study<\/p>\n<p>Multiple individuals of each species were used in each experiment. For details see Supplementary Table <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#MOESM1\" target=\"_blank\" rel=\"noopener\">2<\/a>.<\/p>\n<p>Establishing primary cell cultures<\/p>\n<p>Primary skin fibroblasts were isolated from skin (dermal) tissues as previously described<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 41\" title=\"Seluanov, A., Vaidya, A. &amp; Gorbunova, V. Establishing primary adult fibroblast cultures from rodents. J. Vis. Exp. 44, 2033 (2010).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR41\" id=\"ref-link-section-d50040955e2679\" target=\"_blank\" rel=\"noopener\">41<\/a>. In brief, skin tissues were shaved and cleaned with 70% ethanol. Tissues were minced with a scalpel and incubated in DMEM\/F-12 medium (ThermoFisher) with Liberase (Sigma) at 37\u2009\u00b0C on a stirrer for 15\u201390\u2009min. Tissues were then washed and plated in DMEM\/F-12 medium containing 12% fetal bovine serum (GIBCO) and Antibiotic-Antimycotic (GIBCO). All subsequent maintenance culture for fibroblasts from bowhead and other species was in EMEM (ATCC) supplemented with 12% fetal bovine serum (GIBCO), 100\u2009units\u2009ml\u22121 penicillin, and 100\u2009mg\u2009ml\u22121 streptomycin (GIBCO). All primary cells were cultured at 37\u2009\u00b0C with 5% CO2 and 3% O2 except bowhead whale cells, which were cultured at 33\u2009\u00b0C with 5% CO2 and 3% O2 based on published field measurements of bowhead body temperature, which measured a core temperature of 33.8\u2009\u00b0C and a range of lower temperatures in muscle and peripheral tissue<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 42\" title=\"Elsner, R., Meiselman, H. J. &amp; Baskurt, O. K. Temperature-viscosity relations of bowhead whale blood: a possible mechanism for maintaining cold blood flow. Mar. Mamm. Sci. 20, 339&#x2013;344 (2004).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR42\" id=\"ref-link-section-d50040955e2696\" target=\"_blank\" rel=\"noopener\">42<\/a>,<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 43\" title=\"George, J. C. Growth, Morphology and Energetics of Bowhead Whales (Balaena mysticetus) (University of Alaska Fairbanks, 2009).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR43\" id=\"ref-link-section-d50040955e2699\" target=\"_blank\" rel=\"noopener\">43<\/a>. Prior to beginning experiments with bowhead whale fibroblasts, optimal growth and viability conditions were empirically determined through testing of alternative temperatures, serum concentrations, and cell culture additives, with optimal culture medium found to be the same for bowhead and other species. Following isolation, low population doubling primary cultures were preserved in liquid nitrogen, and population doubling was continually tracked and recorded during subsequent use for experiments.<\/p>\n<p>Established primary fibroblasts from mammals were obtained from San Diego Zoo Wildlife Alliance (hippopotamus, common dolphin and humpback whale) or generated at Huntsman Cancer Institute from bottlenose dolphin tissues collected by Georgia Aquarium through T. Harrison under Institutional Animal Care and Use Committee (IACUC) oversight and California sea lion tissues collected by L. Palmer at the Marine Mammal Care Center Los Angeles (MMCCLA) under a stranding agreement from NOAA Fisheries West Coast Region (WCR). Two male adult and one female wild adult California sea lion were rescued by MMCCLA. The ill animals either died during care or were humanely euthanized under NOAA Fisheries WCR Marine Mammal Euthanasia Best Practices. Necropsy tissues were transferred to Huntsman Cancer Institute under NOAA National Marine Fisheries Service letters of authorization.<\/p>\n<p>Soft agar assay<\/p>\n<p>Fibroblast culture medium as described above was prepared at 2\u00d7 concentration using 2\u00d7 EMEM (Lonza). To prepare the bottom layer of agar plates, 2\u00d7 medium was mixed with a sterile autoclaved solution of 1.2% Noble Agar (Difco) at a 1:1 volumetric ratio, and 3\u2009ml of 1\u00d7 medium\/0.6% agar was pipetted into each 6-cm cell culture dish and allowed to solidify at room temperature in a tissue culture hood. To plate cells into the upper layer of soft agar, cells were collected and washed, and immediately prior to plating were resuspended in 2\u00d7 medium at 20,000 cells per 1.5\u2009ml and diluted twofold in 0.8% Noble Agar pre-equilibrated to 37\u2009\u00b0C. The cells in 0.4% agar\/1\u00d7 medium were pipetted gently to ensure a homogeneous single cell suspension, and 3\u2009ml (20,000 cells) per 6\u2009cm dish were layered on top of the solidified lower layer. After solidifying in tissue culture hoods for 20\u201330\u2009min, additional medium was added to ensure the agar layers were submerged, and dishes were moved into cell culture incubators. Fresh medium was added onto the agar every 3 days. 4 weeks after plating, viable colonies were stained overnight with nitro blue tetrazolium chloride (Thermo Fisher) as previously described<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 44\" title=\"Borowicz, S. et al. The soft agar colony formation assay. J. Vis. Exp. &#010;                https:\/\/doi.org\/10.3791\/51998&#010;                &#010;               (2014).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR44\" id=\"ref-link-section-d50040955e2714\" target=\"_blank\" rel=\"noopener\">44<\/a>. All cell lines were plated in triplicate. For details see Supplementary Table <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#MOESM1\" target=\"_blank\" rel=\"noopener\">2<\/a>.<\/p>\n<p>Images of colonies in soft agar were captured using the ChemiDoc MP Imaging System (Bio-Rad). Colony quantification was performed using ImageJ software (NIH). Initially, images were converted to 8-bit format. Subsequently, the threshold function was adjusted to eliminate any red pixels highlighting non-colony objects. Following threshold adjustment, images were converted to binary. Colony counting was executed using the \u2018Analyze particles\u2019 function with the following parameters: Size (pixel^2)\u2009=\u20091 to infinity; Circularity = 0.5 to 1.<\/p>\n<p>Mouse xenograft assay<\/p>\n<p>NIH-III nude mice (Crl:NIH-Lystbg-J Foxn1nuBtkxid) were purchased from Charles River Laboratories. Seven-week-old female mice were used to establish xenografts and were kept under specific pathogen-free conditions at the vivarium of University of Rochester. Mice were housed in 12\u2009h light:12\u2009h dark cycle, at temperatures 18\u201323\u2009C, with 40\u201360% humidity. For each injection, 2\u2009\u00d7\u2009106 cells were collected and resuspended in 100\u2009\u03bcl of ice-cold 20% matrigel (BD Bioscience) in PBS (Gibco). Mice were anaesthetized with isoflurane gas, and 100\u2009\u03bcl solution per injection was injected subcutaneously into the right and left flanks of each mouse with a 22-gauge needle. Three mice were injected bilaterally, for a total of six injections, per cell line tested. Tumour length and width were measured and recorded every 3\u20134 days. Mice were euthanized after reaching a predetermined humane tumour burden endpoint of a maximum tumour dimension of 20\u2009mm in diameter, determined by the longest dimension of the mouse\u2019s largest tumour. For mice that did not reach tumour burden endpoints, experiments were terminated, and mice euthanized after a maximum of 60 days. Euthanized mice were photographed, and tumours were excised, photographed, and weighed to determine the mass of each tumour. Sections of each tumour were frozen at \u221280\u2009\u00b0C and preserved in formalin. All animal experiments were approved by the University of Rochester Committee for Animal Research, Protocol number 2017-033.<\/p>\n<p>MTT assay<\/p>\n<p>Cell metabolic activity was determined using Thiazolyl Blue Tetrazolium Bromide (MTT) (Sigma). Cells were seeded in 24-well plates at a density of 20,000 cells per well one day before the assay. An MTT solution in PBS was added to the growth medium to achieve a final concentration of 0.5\u2009mg\u2009ml\u22121, and cells were then incubated for 4\u2009h in a CO2 incubator. Following incubation, the growth medium was discarded, and 0.5\u2009ml of DMSO was added to each well to solubilize the purple formazan crystals completely. The plate was further incubated until the crystals were fully dissolved. For details see Supplementary Table <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#MOESM1\" target=\"_blank\" rel=\"noopener\">2<\/a>. Spectrophotometric absorbance of the samples was measured at a wavelength of 570\u2009nm using a Tecan Spark 20\u2009M plate reader.<\/p>\n<p>Telomere lengths<\/p>\n<p>Telomere length was analysed by Southern blot using the TRF method. Genomic DNA was extracted from cultured fibroblasts at different population doublings, digested with a mixture of AluI, HaeIII, RsaI, and HinfI restriction enzymes that do not cut within telomeric repeat sequences, separated using pulsed-field gel electrophoresis, and hybridized with a radiolabelled oligonucleotide containing telomeric sequence (TTAGGG)4. Pulsed-field gels were run using a CHEF-DR II apparatus (Bio-Rad) for 22\u2009h at a constant 45\u2009V, using ramped pulse times from 1 to 10\u2009s.<\/p>\n<p>Telomeric repeat amplification protocol<\/p>\n<p>Telomeric repeat amplification protocol assay was performed using the TRAPeze kit (Chemicon) according to manufacturer instructions. In brief, in the first step of the TRAP assay, radiolabelled substrate oligonucleotide is added to 0.5\u2009\u03bcg of protein extract. If telomerase is present and active, telomeric repeats (GGTTAG) are added to the 3\u2032 end of the oligonucleotide. In the second step, extended products are amplified by PCR. Telomerase extends the oligonucleotide by multiples of 6\u2009bp, generating a ladder of products of increasing length. A human cancer cell line overexpressing telomerase as well as rodent cells were used as a positive control.<\/p>\n<p>CRISPR ribonucleoprotein transfection<\/p>\n<p>CRISPR RNP complexes were formed in vitro by incubating Alt-R S.p.Cas9 Nuclease V3 (Integrated DNA Technologies) with tracRNA annealed to target-specific CRISPR RNA (crRNA) (Integrated DNA Technologies) according to manufacturer instructions. For generation of tumour suppressor knockouts, 3 RNP complexes with crRNAs targeting different sites in a single target gene were combined and Alt-R Cas9 Electroporation Enhancer (Integrated DNA Technologies) was added to transfection mixes prior to electroporation. For comparative analysis of repair fidelity, 3\u2009\u03bcg of pmaxGFP plasmid (Lonza) was added to transfection mixes to monitor transfection efficiency. Cells were trypsinized and washed with PBS, and 1\u2009\u00d7\u2009106 cells were resuspended in 100\u2009\u03bcl of NHDF Nucleofector Solution (Lonza). The cell suspension was then combined with the CRISPR transfection solution and gently mixed prior to electroporation on an Amaxa Nucleofector 2b (Lonza) using program U-23. For details see Supplementary Table <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#MOESM1\" target=\"_blank\" rel=\"noopener\">2<\/a>.<\/p>\n<p>Isolation of clonal cell colonies and screening for tumour suppressor knockout<\/p>\n<p>Following CRISPR transfection, cells were plated at low density in 15\u2009cm dishes to allow for the formation of isolated colonies. Once clonal colonies of sufficient size had formed, positions of well-isolated colonies were visually marked on the bottom of the cell culture dish while under a microscope using a marker. Dishes were aspirated and washed with PBS. Forceps were used to dip PYREX 8\u2009\u00d7\u20098\u2009mm glass cloning cylinders in adhesive Dow Corning high-vacuum silicone grease (Millipore Sigma) and one glass cylinder was secured to the dish over each marked colony. One-hundred and fifty microlitres of trypsin was added to each cylinder and returned to the incubator. When cells had rounded up from the plate, the trypsin in each cylinder was pipetted to detach cells and each colony was added to a separate well in a 6\u2009cm culture dish containing culture medium. After colonies were expanded and split into two wells per colony, one well was collected for western blot screening for absence of target proteins, while the remaining well was kept for further experiments.<\/p>\n<p>Luciferase reporter assays for knockout verification<\/p>\n<p>For p53 activity measurement, 106 cells of control (wild-type) and clonally isolated p53-knockout cell lines were electroporated with 3\u2009\u00b5g p53 firefly luciferase reporter plasmid pp53-TA-Luc (Clontech\/Takara) and 0.3\u2009\u03bcg Renilla luciferase control plasmid pRL-CMV (Promega) on an Amaxa Nucleofector 2b (Lonza). Twenty-four hours later, cells were treated with 200\u2009\u03bcM etoposide (Sigma) to induce p53 activity. Twenty-four hours following etoposide treatment, cells were collected, and luciferase activity of cell lysates was measured using the Dual-Luciferase Reporter Assay System (Promega) in a GloMax 20\/20 Luminometer (Promega) according to manufacturer instructions. For details see Supplementary Table <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#MOESM1\" target=\"_blank\" rel=\"noopener\">2<\/a>.<\/p>\n<p>For RB activity measurement, two different reporters were tested in parallel: pE2F-TA-Luc (Clontech\/Takara) to measure E2F transcriptional activity (repressed by RB), and pRb-TA-Luc (Clontech\/Takara) (promoter element directly suppressed by RB). One million cells of control (wild-type) and clonally isolated RB-knockout cell lines were electroporated with 3\u2009\u00b5g of either pE2F-TA-luc or pRb-TA-luc and 0.3 ug Renilla luciferase plasmid on an Amaxa Nucleofector 2b (Lonza). Following transfection, cells were grown in complete medium for 24\u2009h followed by serum-free medium for 24\u2009h. Cells were then collected, and luciferase activity measured as described above. For details see Supplementary Table <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#MOESM1\" target=\"_blank\" rel=\"noopener\">2<\/a>.<\/p>\n<p>Error-corrected sequencing by SMM-seq of ENU-mutated cells<\/p>\n<p>Skin fibroblasts from mouse, cow, human and whale were isolated and cultured as described before. Confluent cells were treated with 20\u2009mg\u2009ml\u22121 ENU overnight. Then cells were split 1:4 and grown until confluence for collection.<\/p>\n<p>Genomic DNA (gDNA) was isolated from frozen cell pellets using the Quick DNA\/RNA Microprep Plus Kit (Zymo D7005). Three hundred nanograms were used for library preparation as described<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 45\" title=\"Maslov, A. Y. et al. Single-molecule, quantitative detection of low-abundance somatic mutations by high-throughput sequencing. Sci. Adv. 8, eabm3259 (2022).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR45\" id=\"ref-link-section-d50040955e2827\" target=\"_blank\" rel=\"noopener\">45<\/a>: in brief, DNA was enzymatically fragmented, treated for end repair before adapter ligation and exonuclease treatment. A size selection step was performed using a 1.5% cassette on a PippinHT machine prior pulse rolling circle amplification (RCA) and indexing PCR. Library quality was determined with a Tape Station (Agilent) and quantified with Qubit (Thermo Fisher). All libraries were sequenced by Novogene on an Illumina platform.<\/p>\n<p>Sequencing analysis and mutation calling were performed as described<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 45\" title=\"Maslov, A. Y. et al. Single-molecule, quantitative detection of low-abundance somatic mutations by high-throughput sequencing. Sci. Adv. 8, eabm3259 (2022).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR45\" id=\"ref-link-section-d50040955e2834\" target=\"_blank\" rel=\"noopener\">45<\/a>, using the following tools: Python v.2.7.18, TrimGalore v.0.4.1, BWA v.0.7.13, Samtools v.1.9, Picard v.1.119, GenomeAnalysisTK v.3.5, Bcftools v.1.9, and tabix v.0.2.6. Mutations were called using SMM (<a href=\"https:\/\/github.com\/msd-ru\/SMM\" target=\"_blank\" rel=\"noopener\">https:\/\/github.com\/msd-ru\/SMM<\/a>). Downstream analyses were conducted in R v.4.3.3 with MutationalPatterns v.3.12.0. Germline variants were distinguished from somatic mutations by additional filtering steps after alignment to the reference genome.<\/p>\n<p>Graphs were generated and statistical testing was performed using GraphPad Prism.<\/p>\n<p>Next-generation sequencing of CRISPR repair products<\/p>\n<p>Seventy-two hours after transfection, cells were collected, and genomic DNA was isolated with the Wizard Genomic DNA Purification Kit (Promega). DNA concentration was measured on a Nanodrop spectrophotometer and 100\u2009ng of DNA per sample was PCR-amplified with KAPA2G Robust HotStart ReadyMix (Roche) based on findings of low PCR bias for KAPA polymerase<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 46\" title=\"Quail, M. A. et al. Optimal enzymes for amplifying sequencing libraries. Nat. Methods 9, 10&#x2013;11 (2012).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR46\" id=\"ref-link-section-d50040955e2856\" target=\"_blank\" rel=\"noopener\">46<\/a>,<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 47\" title=\"Blackburn, M. C. Development of New Tools and Applications for High-throughput Sequencing of Microbiomes in Environmental or Clinical Samples. B. S. thesis, MIT (2010).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR47\" id=\"ref-link-section-d50040955e2859\" target=\"_blank\" rel=\"noopener\">47<\/a>. Primers targeted a conserved region surrounding PTEN exon 1 (Extended Data Fig. <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"figure anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#Fig9\" target=\"_blank\" rel=\"noopener\">4a<\/a>). PCR was performed according to manufacturer instructions, with an annealing temperature of 66\u2009\u00b0C for 30 cycles. To purify samples for next-generation sequencing, PCR products were electrophoresed on a 0.8% agarose gel and post-stained with SYBR Gold Nucleic Acid Gel Stain (Thermo Fisher). Gels were visualized on a blue light tray (Bio-Rad) to minimize damage to DNA. A gel slice for each lane was excised using a scalpel, and each slice was cut to include the region ranging from just above the prominent PTEN PCR band down to and including the \u2018primer dimer\u2019 region to ensure inclusion of any deletion alleles. DNA was extracted from gel slices using the QiaQuick Gel Extraction Kit (Qiagen), and triplicate PCR reaction eluates per sample were pooled for sequencing. Sample concentrations were measured by Nanodrop and adjusted as necessary prior to submission for 2\u00d7\u2009250\u2009bp paired-end Illumina MiSeq sequencing with target depth of &gt;40,000 reads per sample (Genewiz). For details see Supplementary Table <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#MOESM1\" target=\"_blank\" rel=\"noopener\">2<\/a>.<\/p>\n<p>Analysis of CRISPR NGS data<\/p>\n<p>FASTQ files from each sequenced sample were analysed with both CRISPResso2<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 48\" title=\"Clement, K. et al. CRISPResso2 provides accurate and rapid genome editing sequence analysis. Nat. Biotechnol. 37, 224&#x2013;226 (2019).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR48\" id=\"ref-link-section-d50040955e2883\" target=\"_blank\" rel=\"noopener\">48<\/a>, which uses an alignment-based algorithm, and CRISPRPic<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 49\" title=\"Lee, H. J., Chang, H. Y., Cho, S. W. &amp; Ji, H. P. CRISPRpic: fast and precise analysis for CRISPR-induced mutations via prefixed index counting. NAR Genomics Bioinformatics 2, lqaa012 (2020).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR49\" id=\"ref-link-section-d50040955e2887\" target=\"_blank\" rel=\"noopener\">49<\/a>, which uses a kmer-based algorithm. CRISPResso2 was run using the following parameters: window size = 30, maximum paired-end overlap = 500, bp excluded from left and right ends = 15, minimum alignment score = 50, minimum identity score = 50, plot window size = 20. For CRISPRPic analysis, SeqPrep<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 50\" title=\"St John, J. et al. SeqPrep: tool for stripping adaptors and\/or merging paired reads with overlap into single reads. &#010;                https:\/\/github.com\/jstjohn\/SeqPrep&#010;                &#010;               (2016).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR50\" id=\"ref-link-section-d50040955e2891\" target=\"_blank\" rel=\"noopener\">50<\/a> was used to merge overlapping read pairs and trim adapter sequences. CRISPRPic was run on merged FASTQ sequences for each sample with the following parameters: index size = 8, window size = 30.<\/p>\n<p>HPRT mutation assay<\/p>\n<p>For the HPRT mutation assay, cells used were low-passage primary dermal fibroblasts from multiple species that were known to originate from male animals, to ensure single copy number of the X-linked HPRT gene. Each species was tested with three different cell lines from three individual animals. The bowhead HPRT coding sequence was BLASTed against bowhead genome scaffolds<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 13\" title=\"Keane, M. et al. Insights into the evolution of longevity from the bowhead whale genome. Cell Rep. 10, 112&#x2013;122 (2015).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR13\" id=\"ref-link-section-d50040955e2910\" target=\"_blank\" rel=\"noopener\">13<\/a> and neighbouring gene sequences were analysed to confirm mammal-typical localization of HPRT on the bowhead X-chromosome. Cells were cultured in standard fibroblast growth medium, but with FBS being replaced with dialysed FBS (Omega Scientific) and supplemented with Fibroblast Growth Kit Serum-Free (Lonza) to improve growth and viability in dialysed FBS. Dialysed FBS was found in optimization experiments to be necessary for efficient 6-thioguanine selection. Prior to mutagenesis, cells were cultured for 7 days in medium containing HAT Supplement (Gibco) followed by 4 days in HT Supplement (Gibco) to eliminate any pre-existing HPRT mutants. To induce mutations, cells were incubated for 3\u2009h in serum-free MEM containing either 150\u2009\u00b5g\u2009ml\u22121 ENU (Sigma), 10\u2009\u00b5M MNNG (Selleck Chemicals), or 1,200\u2009\u00b5g\u2009ml\u22121 EMS (Sigma), or were exposed to 2\u2009Gy \u03b3-irradiation. Cells were then maintained in ENU-free medium for 9 days to allow mutations to establish and existing HPRT to degrade. One million cells from each cell line were collected and plated in dialysed FBS medium containing 5\u2009\u00b5g\u2009ml\u22121 6-thioguanine (Chem-Impex), in parallel with 106 untreated control cells for each cell line. Cells were plated at a density of 105 cells per 15-cm dish (2.5\u2009\u00d7\u2009105 cells per 10-cm dish in MNNG and EMS experiments) to allow for efficient selection and colony separation, and to prevent potential \u2018metabolic cooperation\u2019<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 51\" title=\"Johnson, G. E. in Genetic Toxicology (eds Parry, J. M. &amp; Parry, E. M.) 55&#x2013;67 (Humana Press, 2012).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR51\" id=\"ref-link-section-d50040955e2930\" target=\"_blank\" rel=\"noopener\">51<\/a>. In tandem, for each cell line 200 cells (50 cells in MNNG and EMS experiments) from untreated and control conditions were plated in triplicate 10-cm dishes in non-selective medium to calculate plating efficiency. After 3\u20134 weeks of growth, surviving colonies were fixed and stained with a crystal violet\/glutaraldehyde solution as previously described<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 52\" title=\"Franken, N. A. P., Rodermond, H. M., Stap, J., Haveman, J. &amp; van Bree, C. Clonogenic assay of cells in vitro. Nat. Protoc. 1, 2315&#x2013;2319 (2006).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR52\" id=\"ref-link-section-d50040955e2935\" target=\"_blank\" rel=\"noopener\">52<\/a>. Colonies were counted, and HPRT mutation rate was calculated as plating efficiency adjusted number of HPRT-negative colonies containing &gt;50 cells. Appropriate concentrations of ENU, MNNG, EMS and 6-thioguanine, as well as optimal plating densities and growth conditions, were determined prior to the experiment described above through optimization and dose titration experiments. For details see Supplementary Table <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#MOESM1\" target=\"_blank\" rel=\"noopener\">2<\/a>.<\/p>\n<p>Digital droplet PCR measurement of CRISPR cleavage rate<\/p>\n<p>A ddPCR assay similar to a previously published method<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 53\" title=\"Rose, J. C. et al. Rapidly inducible Cas9 and DSB-ddPCR to probe editing kinetics. Nat. Methods 14, 891 (2017).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR53\" id=\"ref-link-section-d50040955e2950\" target=\"_blank\" rel=\"noopener\">53<\/a> was used for time-course quantification of CRISPR DSB induction across species. Quantitative PCR primers at conserved sites flanking the guide RNA target site in the PTEN gene were designed such that cleavage would prevent PCR amplification. As an internal copy number reference control, a second set of previously validated quantitative PCR primers targeting an ultraconserved element present in all mammals as a single copy per genome (UCE.359) was designed based on published sequences<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 54\" title=\"Hudon, S. F. et al. Primers to highly conserved elements optimized for qPCR-based telomere length measurement in vertebrates. Mol. Ecol. Resour. 21, 59&#x2013;67 (2021).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR54\" id=\"ref-link-section-d50040955e2957\" target=\"_blank\" rel=\"noopener\">54<\/a>. To allow for multiplexing and copy number normalization of PTEN within each ddPCR reaction, 5\u2019 fluorescent hydrolysis probes (FAM for PTEN and HEX for UCE.359) targeting conserved sequences were designed, with 3\u2018 Iowa Black and internal ZEN quenchers (Integrated DNA Technologies). All primers and probes were checked for specificity by BLAST against each species\u2019 genome<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 54\" title=\"Hudon, S. F. et al. Primers to highly conserved elements optimized for qPCR-based telomere length measurement in vertebrates. Mol. Ecol. Resour. 21, 59&#x2013;67 (2021).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR54\" id=\"ref-link-section-d50040955e2968\" target=\"_blank\" rel=\"noopener\">54<\/a>. Fibroblasts were transfected with PTEN CRISPR RNP as described in \u2018Next-generation sequencing of CRISPR repair products\u2019 and returned to cell culture incubators. At the indicated times post-transfection, cells were collected, flash frozen and genomic DNA was isolated with the Wizard Genomic DNA Purification Kit (Promega). During isolation, newly lysed cells were treated with Proteinase K and RNase A for 30\u2009min each at 37\u2009\u00b0C to minimize the possibility of residual CRISPR RNP activity. DNA concentration was measured on a Nanodrop spectrophotometer, and genomic DNA was predigested with BamHI-HF (NEB) and XhoI (NEB), which do not cut within target amplicons, to maximize PCR efficiency and distribution across droplets. 15\u2009ng of genomic DNA per sample was added to duplicate PCR reactions using the ddPCR Supermix for Probes (No dUTP) master mix (Bio-Rad). Droplets were prepared and measured according to manufacturer instructions. In brief, each 20\u2009\u00b5l reaction was mixed with 70\u2009\u00b5l Droplet Generation Oil for Probes (Bio-Rad) and droplets were formed in a QX100 Droplet Generator (Bio-Rad). Forty microlitres of droplets per reaction were transferred to 96-well PCR plates and sealed with a PX1 PCR Plate Sealer (Bio-Rad). The sealed plates were then subjected to PCR using a pre-optimized cycling protocol. Following PCR, the plates were loaded into a QX100 Droplet Reader (Bio-Rad) and each droplet measured on both FAM and HEX channels. PTEN copy number normalized to UCE.359 reference copy number within each well was determined with QuantaSoft software (Bio-Rad). For each species, positive\/negative gates in mock-transfected control samples were adjusted as necessary to compensate for differences in multiplex PCR efficiency\/specificity and \u2018rain\u2019 droplets between species and bring normalized PTEN copy number closer to 1. The control gates were then applied across all samples\/time points within the same species and used for PTEN copy number calculation. For details see Supplementary Table <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#MOESM1\" target=\"_blank\" rel=\"noopener\">2<\/a>.<\/p>\n<p>Flow cytometric measurement of CRISPR RNP transfection efficiency<\/p>\n<p>CRISPR RNP transfections were performed as described above, but with ATTO-550 fluorescently labelled trans-activating CRISPR RNA (tracRNA) (Integrated DNA Technologies). At 0\u2009h and 24\u2009h post-transfection, cells were collected, pelleted and analysed by flow cytometry on a CytoFlex S Flow Cytometer (Beckman Coulter). Gain and ATTO-550 positive gates were set based on mock-transfected control cells included in each experiment. For details see Supplementary Table <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#MOESM1\" target=\"_blank\" rel=\"noopener\">2<\/a>.<\/p>\n<p>Senescence-associated \u03b2-galactosidase staining<\/p>\n<p>Senescence-associated \u03b2-galactosidase (SA-\u03b2-gal) staining was performed as previously described<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 55\" title=\"Dimri, G. P. et al. A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc. Natl Acad. Sci. USA 92, 9363 (1995).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR55\" id=\"ref-link-section-d50040955e3009\" target=\"_blank\" rel=\"noopener\">55<\/a>,<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 56\" title=\"Debacq-Chainiaux, F., Erusalimsky, J. D., Campisi, J. &amp; Toussaint, O. Protocols to detect senescence-associated beta-galactosidase (SA-&#x3B2;gal) activity, a biomarker of senescent cells in culture and in vivo. Nat. Protoc. 4, 1798&#x2013;1806 (2009).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR56\" id=\"ref-link-section-d50040955e3012\" target=\"_blank\" rel=\"noopener\">56<\/a>. Cells were washed twice with PBS and fixed in a solution containing 2% formaldehyde and 0.2% glutaraldehyde in PBS for 5\u2009min at room temperature. After fixation, cells were immediately washed twice with PBS and stained in a solution containing 1\u2009mg\u2009ml\u22121 X-Gal, 40\u2009mM citric acid\/sodium phosphate buffer, pH 6.0, 5\u2009mM potassium ferrocyanide, 5\u2009mM potassium ferricyanide, 150\u2009mM NaCl, and 2\u2009mM MgCl2. Plates were incubated at 37\u2009\u00b0C for 16\u2009h without CO2. Colorimetric images were taken from different areas of each plate and quantified. For details see Supplementary Table <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#MOESM1\" target=\"_blank\" rel=\"noopener\">2<\/a>.<\/p>\n<p>Cell survival assay<\/p>\n<p>Percentage of live cells was quantified using the Annexin V FLUOS Staining Kit (Roche) and Annexin V Apoptosis Kit (FITC) (Novus Biologicals) following the manufacturer\u2019s instructions. After staining, cells were analysed on a CytoFlex S flow cytometer (Beckman Coulter). Where indicated cell viability was assessed using a trypan blue exclusion assay. All cells (both floated and attached to the culture dish) were collected into the same tube, centrifuged, and resuspended in PBS. The cells were then mixed in a 1:1 ratio with 0.4% trypan blue solution, and approximately 3\u2009min later, the percentage of dead cells was assessed using the Countess 3FL instrument (ThermoFisher) according to the manufacturer\u2019s instructions. For details see Supplementary Table <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#MOESM1\" target=\"_blank\" rel=\"noopener\">2<\/a>.<\/p>\n<p>Clonogenic assay<\/p>\n<p>The clonogenic assay was performed following a previously published protocol<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 52\" title=\"Franken, N. A. P., Rodermond, H. M., Stap, J., Haveman, J. &amp; van Bree, C. Clonogenic assay of cells in vitro. Nat. Protoc. 1, 2315&#x2013;2319 (2006).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR52\" id=\"ref-link-section-d50040955e3044\" target=\"_blank\" rel=\"noopener\">52<\/a>. In brief, serial dilutions of drug-treated cells were plated immediately after treatment. The cells were incubated until colonies formed, which required two weeks for human cells and three weeks for bowhead whale cells. Colonies were then fixed and stained using a solution containing 6.0% glutaraldehyde and 0.5% crystal violet, followed by counting. Cell survival at each drug dose was expressed as the relative plating efficiency of the treated cells compared to the control cells. Data analyses were performed using GraphPad Prism software.<\/p>\n<p>p53 activity<\/p>\n<p>To test p53 activity in cultured primary fibroblasts, 150,000 cells were seeded in 6-well plates 1 day before transfection with 1\u2009\u03bcg pp53-TA-Luc vector (Clontech) and 0.015\u2009\u03bcg pRL-CMV-Renilla (Promega) to normalize for transfection efficiency. Transfections were performed using PEI MAX Transfection Grade Linear Polyethylenimine Hydrochloride (MW 40,000) (Polysciences) according to manufacturer instructions. 24\u2009h after transfections cells were lysed using 50\u2009\u00b5l passive lysis buffer (Promega) per 105 cells and flash frozen\/thawed two times in liquid nitrogen and a 37\u2009\u00b0C water bath. Luciferase assays were performed using the Dual-Luciferase Reporter Assay System (Promega) and program DLR-2-INJ on a Glomax 20\/20 Luminometer (Promega) with 20\u2009\u03bcl cell extract as the input. For details see Supplementary Table <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#MOESM1\" target=\"_blank\" rel=\"noopener\">2<\/a>.<\/p>\n<p>Generation of NHEJ and HR reporter cell lines<\/p>\n<p>NHEJ and HR reporter constructs<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 57\" title=\"Seluanov, A., Mao, Z. &amp; Gorbunova, V. Analysis of DNA Double-strand Break (DSB) repair in mammalian cells. J. Vis. Exp. &#010;                https:\/\/doi.org\/10.3791\/2002&#010;                &#010;               (2010).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR57\" id=\"ref-link-section-d50040955e3070\" target=\"_blank\" rel=\"noopener\">57<\/a> were digested with NheI restriction enzyme and purified with the QIAEX II gel extraction kit (QIAGEN). The same plasmid DNA preparation was used for generating all reporter cell lines of the studied species. Cells with PD\u20092.<\/p>\n<p>DSB repair assays and flow cytometry analysis<\/p>\n<p>DSB repair assays were performed as previously described<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 58\" title=\"Mao, Z. et al. SIRT6 promotes DNA repair under stress by activating PARP1. Science 332, 1443&#x2013;1446 (2011).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR58\" id=\"ref-link-section-d50040955e3085\" target=\"_blank\" rel=\"noopener\">58<\/a>. In brief, growing cells were co-transfected with 3\u2009\u00b5g of plasmid encoding I-SceI endonuclease and 0.03\u2009\u00b5g of plasmid encoding DsRed. The same batch of I-SceI and DsRed mixture was used throughout all species to avoid batch-to-batch variation. To test the effect of CIRBP on DSB repair, 3\u2009\u00b5g of CIRBP plasmids were co-transfected with I-SceI and DsRed plasmids. Three days after transfection, the numbers of GFP+ and DsRed+ cells were determined by flow cytometry on a CytoFlex S Flow Cytometer (Beckman Coulter). For each sample, a minimum of 50,000 cells was analysed. DSB repair frequency was calculated by dividing the number of GFP+ cells by the number of DsRed+ cells. For details see Supplementary Table <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#MOESM1\" target=\"_blank\" rel=\"noopener\">2<\/a> and Supplementary Fig. <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#MOESM1\" target=\"_blank\" rel=\"noopener\">7<\/a>.<\/p>\n<p>For NHEJ knockdown experiments, bowhead whale cells containing the NHEJ reporter were transfected with 120\u2009pmol of anti-bwCIRBP or control siRNAs (Dharmacon) three days before I-SceI\/DsRed transfections using an Amaxa Nucleofector (U-023 program). For HR knockdown experiments, bowhead whale cells containing the HR reporter were transfected twice every three days with a final concentration of 10\u2009nM anti-bwCIRBP or negative control siRNAs (Silencer Select, Thermo Fisher) using Lipofectamine RNAiMAX transfection reagent (Thermo Fisher) following the manufacturer\u2019s instructions. Cells were further transfected with I-SceI\/DsRed plasmids using a 4D-Nucleofector (P2 solution, DS150 program). The efficiency of knockdown was determined by western blot. For details see Supplementary Table <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#MOESM1\" target=\"_blank\" rel=\"noopener\">2<\/a>.<\/p>\n<p>For the extrachromosomal assay and fidelity analysis, NHEJ reporter plasmid was digested with I-Sce1 for 6\u2009h and purified using a QIAEX II Gel Extraction Kit (QIAGEN). Exponentially growing cells were transfected using an Amaxa nucleofector with the U-023 program. In a typical reaction, 106 cells were transfected with 0.25\u2009\u00b5g of predigested NHEJ reporter substrate along with 0.025\u2009\u00b5g of DsRed to serve as a transfection control. Seventy-two hours after transfection, cells were collected and analysed by flow cytometry on a BD LSR II instrument. At least 20,000 cells were collected for each sample. Immediately after FACS, genomic DNA was isolated from cells using the QIAGEN Blood &amp; Tissue kit. DSB repair sites in the NHEJ construct were amplified by PCR using Phusion polymerase (NEB), cloned using the TOPO Blunt cloning kit (NEB), and sent for Sanger sequencing. At least 100 sequenced clones were aligned and analysed using the ApE software (v.3.1.6). For details see Supplementary Table <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#MOESM1\" target=\"_blank\" rel=\"noopener\">2<\/a>.<\/p>\n<p>Western blotting<\/p>\n<p>All antibodies were checked for conservation of the target epitope in the protein sequence of each included species, and only those targeting regions conserved across these species were used. For a limited number of proteins where the available antibodies with specific epitope information disclosed did not target conserved regions, we selected antibodies based on demonstrated reactivity across a broad range of mammal species and always confirmed these results with multiple antibodies. Information on antibodies is provided in Supplementary Table <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#MOESM1\" target=\"_blank\" rel=\"noopener\">2<\/a>.<\/p>\n<p>Exponentially growing cells were collected with trypsin and counted, and 106 cells were resuspended in 100\u2009\u00b5l of PBS containing protease inhibitors. 100\u2009\u00b5l of 2\u00d7 Laemmli buffer (Bio-Rad) was added, and samples were boiled at 95\u2009\u00b0C for 10\u2009min. Samples were separated with 4\u201320% gradient SDS\u2013PAGE, transferred to a PVDF membrane, and blocked in 5% milk-TBS-T for 2\u2009h at room temperature. Membranes were incubated overnight at +4\u2009\u00b0C with primary antibodies in 5% milk-TBS-T. After 3 washes for 10\u2009min with TBS-T, membranes were incubated for 1\u2009h at room temperature with secondary antibodies conjugated with HRP or a fluorophore. After 3 washes with TBS-T signal was developed for HRP secondaries with Clarity Western ECL Substrate (Bio-Rad). CIRBP expression was measured with 3 different antibodies targeting conserved epitopes (Extended Data Fig. <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"figure anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#Fig12\" target=\"_blank\" rel=\"noopener\">7d<\/a>).<\/p>\n<p>For detecting chromatin-bound proteins, cells were lysed in 1\u2009ml of CSK buffer (10\u2009mM Pipes pH 6.8, 100\u2009mM NaCl, 300\u2009mM sucrose, 3\u2009mM MgCl2, 1\u2009mM EGTA, 0.2% Triton X-100) or CSK\u2009+\u2009R buffer (10\u2009mM Pipes pH 6.8, 100\u2009mM NaCl, 300\u2009mM sucrose, 3\u2009mM MgCl2, 1\u2009mM EGTA, 0.2% Triton X-100, and 0.3\u2009mg\u2009ml\u22121 RNAse A) at +4\u2009\u00b0C for 30\u2009min with gentle rotation. Samples were centrifuged for 10\u2009min at 10,000g at 4\u2009\u00b0C, and the supernatant was discarded. Pellets were washed twice with 1\u2009ml of CSK\/CSK\u2009+\u2009R buffer, resuspended in PBS, and an equal volume of 2\u00d7 Laemmli buffer (Bio-Rad) was added. Samples were boiled at 95\u2009\u00b0C for 10\u2009min and subjected to western blotting as described above.<\/p>\n<p>For analysing CIRBP expression in mice and bowhead whale tissues, tissues were pulverized using the cell crusher. For each 5\u2009mg of tissue, 300\u2009\u00b5l of 4\u00d7 Laemmli buffer (Bio-Rad) was added, samples were extensively vortexed, and boiled at 95\u2009\u00b0C with 1,000\u2009rpm for 10\u2009min.<\/p>\n<p>To analyse CIRBP expression in flies, 25 flies were homogenized in 250\u2009\u00b5l of ice-cold RIPA buffer containing protease inhibitors (ThermoFisher) and incubated for 1\u2009h at 4\u2009\u00b0C with continuous shaking. Subsequently, 250\u2009\u00b5l of 4\u00d7 Laemmli buffer (Bio-Rad) was added, the samples were thoroughly vortexed, and then boiled at 95\u2009\u00b0C with shaking at 600\u2009rpm for 12\u2009min. Samples were centrifuged at 16,000g for 5\u2009min, and the supernatant was used for western blot analysis.<\/p>\n<p>Antibody dilutions used for this study were as follows: Anti-DNA-PKcs antibody (ab70250, 1:1,000), Rabbit polyclonal anti-Ku80\/XRCC5 (NB100-503, 1:500), Ku70 (D10A7) Rabbit monoclonal antibody (4588S, 1:1,000), Rabbit polyclonal anti-Mre11 (NB100-142, 1:5,000), Rabbit polyclonal anti-Rad50 (NBP2-20054, 1:1,000), Rabbit polyclonal anti-Nbs1 (NB100-143, 1:1,000), Rabbit polyclonal anti-PARP1 (NBP2-13732, 1:1,000), SirT6 (D8D12) Rabbit monoclonal antibody (12486S, 1:1,000), RPA34 (RPA2) Mouse Monoclonal Antibody (TA500765, 1:1,000), Rabbit monoclonal (EPR18783) anti-CIRP (ab191885, 1:1,000), Rabbit polyclonal anti-p53 (ab131442, 1:1,000), Rabbit polyclonal anti-RB (ab226979, 1:1,000), PTEN (D4.3) XP Rabbit monoclonal antibody (9188S, 1:1,000), Ras (G12V Mutant Specific) (D2H12) Rabbit monoclonal antibody (14412S, 1:1,000), SV40 large T antigen (D1E9E) Rabbit monoclonal antibody (15729S, 1:1,000), Rabbit polyclonal anti-histone H3 (ab1791, 1:10,000), Rabbit polyclonal anti-beta actin (ab8227, 1:5,000), Poly\/Mono-ADP-Ribose (E6F6A) Rabbit monoclonal antibody (83732, 1:1,000), CtIP (D76F7) Rabbit monoclonal antibody (9201S, 1:1,000), Goat anti-mouse IgG H&amp;L (HRP) (ab6789, 1:5,000), Goat anti-rabbit IgG H&amp;L (HRP) (ab6721, 1:5,000).<\/p>\n<p>Expression and purification of bowhead whale CIRBP protein<\/p>\n<p>N-terminal histidine-tagged (6\u00d7His) CIRBP was cloned into a pET11a expression vector. The plasmid was transformed into Rosetta gami B (DE3) pLysS competent Escherichia coli for protein expression. Bacteria were grown at 37\u2009\u00b0C to an optical density (OD600) of 2.0 and protein expression was induced by adding 0.4\u2009mM isopropyl \u03b2-d-1-thiogalactopyranoside (IPTG) for 20\u2009h at 23\u2009\u00b0C. Bacteria were collected by centrifugation and pellets were flash frozen on liquid nitrogen and stored at \u221280\u2009\u00b0C. In Bacteria were resuspended in lysis buffer consisting of 50\u2009mM Tris pH 7.5, 2.0\u2009M NaCl, 50\u2009mM imidazole, 10\u2009mg lysozyme, 0.1% Triton X-100, 1\u2009mM DTT and protease inhibitors. The bacterial pellets were sonicated, rotated for 1\u2009h at 4\u2009\u00b0C, and sonicated again. The bacterial lysate was clarified by centrifugation at 22,000g for 20\u2009min at 4\u2009\u00b0C and the supernatant passed through a 0.45-\u00b5m filter. The clarified lysate was purified using Ni-NTA agarose beads (Qiagen) washed with 20 column volumes of water and 20 column volumes of buffer containing 50\u2009mM Tris pH 7.5, 2.0\u2009M NaCl, 1\u2009mM DTT, and 50\u2009mM imidazole (wash buffer 1). The lysate was placed onto the washed beads and transferred to a 50\u2009ml conical tube and rotated for 3\u2009h at 4\u2009\u00b0C. The suspended beads were pelleted by centrifugation and washed with 40 column volumes wash buffer 1 and 10 column volumes with buffer containing 50\u2009mM Tris pH 7.5, 150\u2009mM NaCl, 1\u2009mM DTT, and 50\u2009mM imidazole. CIRBP was eluted by adding 5 column volumes of buffer containing 50\u2009mM Tris pH 7.5, 150\u2009mM NaCl, 1\u2009mM DTT, and 500\u2009mM imidazole and rotated the conical tube for 15\u2009minutes at 4\u2009\u00b0C. The supernatant was collected by centrifugation and filtered before adding 5% glycerol. The protein was aliquoted, and flash frozen on liquid nitrogen and stored at \u221280\u2009\u00b0C.<\/p>\n<p>NHEJ ligation in vitro assay<\/p>\n<p>The assay was performed essentially as described<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 59\" title=\"Vu, D.-D. et al. Multivalent interactions of the disordered regions of XLF and XRCC4 foster robust cellular NHEJ and drive the formation of ligation-boosting condensates in vitro. Nat. Struct. Mol. Biol. 31, 1732&#x2013;1744 (2024).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR59\" id=\"ref-link-section-d50040955e3187\" target=\"_blank\" rel=\"noopener\">59<\/a>,<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 60\" title=\"Roy, S. et al. XRCC4\/XLF interaction is variably required for DNA Repair and is not required for ligase IV stimulation. Mol. Cell. Biol. 35, 3017&#x2013;3028 (2015).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR60\" id=\"ref-link-section-d50040955e3190\" target=\"_blank\" rel=\"noopener\">60<\/a>. Reaction mixtures (10\u2009\u03bcl) contained 20\u2009mM Tris-HCl (pH 7.5), 8\u2009mM MgCl2, 0.1\u2009mM ATP, 2\u2009mM DTT, 0.1\u2009M KCl, 2% Glycerol, 4% PEG 8000, 1\u2009nM linearized pUC19 (with cohesive ends via XbaI; 17.3\u2009ng), 10\u2009nM XRCC4\u2013ligase IV complex, and 0.5 or 1\u2009\u03bcM human CIRBP. When indicated, reaction mixtures also contained 10\u2009nM Ku70\/80 heterodimer, 1\u2009\u03bcM XLF dimer, or 1\u2009\u03bcM PAXX dimer. The reaction mixtures were incubated for 1\u2009h at 30\u2009\u00b0C, followed by the addition of 2\u2009\u03bcl of Gel Loading Dye, Purple (6\u00d7) (NEB), and incubation for 5\u2009min at 65\u2009\u00b0C. Subsequently, 4\u2009\u03bcl of each sample was loaded onto a 0.7% agarose gel and subjected to gel electrophoresis (50\u2009V, 50\u2009min). The gel was stained with ethidium bromide, and DNA bands were visualized using a ChemiDoc MP (Bio-Rad).<\/p>\n<p>CIRBP-mediated protection of DNA ends from exonuclease degradation<\/p>\n<p>To assess CIRBP\u2019s ability to protect DNA ends, two complementary in vitro protection assays were performed using either linearized plasmid DNA or a short Cy5-labelled double-stranded oligonucleotide substrate mimicking a DSB end<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 61\" title=\"Conlin, M. P. et al. DNAligase IV guides end-processing choice during nonhomologous end joining. Cell Rep. 20, 2810&#x2013;2819 (2017).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR61\" id=\"ref-link-section-d50040955e3205\" target=\"_blank\" rel=\"noopener\">61<\/a>.<\/p>\n<p>For the plasmid-based assay, a 20\u2009\u00b5l reaction containing 2.9\u2009nM of 6.7\u2009kb BamHI-linearized plasmid DNA with cohesive ends was mixed with the indicated concentrations of human recombinant CIRBP in buffer containing 20\u2009mM Tris-HCl (pH 7.5), 20\u2009mM KCl, 10\u2009mM MgCl2, 1\u2009mM DTT, 2.5% glycerol, and 0.5% PEG8000. The reaction was incubated at 25\u2009\u00b0C for 30\u2009min. Subsequently, 5 units of T7 exonuclease (NEB) were added, and digestion was carried out for 10\u2009min at 25\u2009\u00b0C. Reactions were stopped by adding 6\u00d7 Gel Loading Dye, Purple (NEB), which contains SDS and EDTA, followed by incubation at 65\u2009\u00b0C for 5\u2009min. Samples were analysed by agarose gel electrophoresis and stained with ethidium bromide.<\/p>\n<p>For the short DNA substrate assay, a 20\u2009\u00b5l reaction containing 10\u2009nM of a 20\u2009bp Cy5-labelled double-stranded DNA substrate mimicking a DSB end was incubated with human recombinant CIRBP in the same reaction buffer at 25\u2009\u00b0C for 30\u2009min. After addition of 5 units of T7 exonuclease, reactions were continued for 10\u2009min at 25\u2009\u00b0C. Reactions were stopped by adding 6\u00d7 loading buffer (20\u2009mM Tris-HCl pH 7.5, 60% glycerol, 1% SDS, 60\u2009mM EDTA) and incubated at 42\u2009\u00b0C for 10\u2009min. Samples were resolved on a 20% native polyacrylamide gel and visualized using a ChemiDoc imaging system (Bio-Rad).<\/p>\n<p>The sequences of the DSB-mimicking oligonucleotides were as follows: top strand, \/5PHOS\/TCACACACGCACGCATTTTT; bottom strand: \/5CY5\/TTTTTTGCGTGCGTGTGTGA.<\/p>\n<p>For details see Supplementary Table <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#MOESM1\" target=\"_blank\" rel=\"noopener\">2<\/a>.<\/p>\n<p>EMSA<\/p>\n<p>Recombinant human CIRP protein was incubated in the indicated amounts with the indicated nucleic acid substrates in 20\u2009\u00b5l EMEM (ATCC) at 37\u2009\u00b0C for 1\u2009h. Subsequently, reactions were mixed with 4\u2009\u00b5l sucrose loading dye (2\u2009M sucrose + 0.2% Orange G) and loaded into agarose gels immersed in 0.5\u00d7 TAE buffer followed by electrophoresis at 30\u2009V. Following electrophoresis, gels were stained in 1\u00d7 SYBR Gold (Thermo Fisher Scientific) and imaged. Extraction of genomic DNA from human primary fibroblasts was with the Monarch HMW DNA Extraction Kit for Cells &amp; Blood (NEB T3050L). To produce the damaged DNA samples and induce PAR formation, cells were treated with H2O2 and UV prior to genomic DNA extraction. For H2O2 treatment, culture medium was replaced with medium containing 400\u2009\u03bcM H2O2 that had been diluted into the medium immediately prior to use. For UV treatment, culture medium was aspirated and replaced with a thin layer of PBS. Cells were exposed to 6\u2009J\u2009m\u22122 UVC in a UV Crosslinker (Fisher Scientific) with the culture dish lid removed. During genomic DNA extraction from damaged chromatin, Proteinase K was added per manufacturer instructions, but RNase A was omitted, and Protector Rnase inhibitor (Sigma-Aldrich) was added to the extraction buffers and eluate. Nucleic acids used in reactions were sonicated to uniform size in a QSONICA Sonicator.<\/p>\n<p>For the Ku-binding assays, binding reactions (10\u2009\u00b5l) contained 50\u2009nM of a double-stranded DNA substrate (top strand: 5\u2032-Cy5\u2013GATCCCTCTAGATATCGGGCCCTCGATCCG-3\u2032), along with the indicated protein concentrations in a buffer comprising 20\u2009mM Tris-HCl (pH 7.5), 20\u2009mM NaCl, 15\u2009mM KCl, 1\u2009mM EDTA, 1\u2009mM DTT, and 2.5% (vol\/vol) glycerol. Reactions were incubated at room temperature for 20\u2009min and then resolved on a native 6% acrylamide gel using 0.5\u00d7 TBE as the running buffer. The Cy5 fluorescent signal was captured using a ChemiDoc imaging system (Bio-Rad).<\/p>\n<p>For details see Supplementary Table <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#MOESM1\" target=\"_blank\" rel=\"noopener\">2<\/a>.<\/p>\n<p>PARP activity<\/p>\n<p>PARP activity was measured in cell nuclear extracts with the PARP Universal Colorimetric Assay Kit (Trevigen) according to the manufacturer\u2019s instructions. Nuclear extracts were prepared using EpiQuik Nuclear Extraction Kit (EpigenTek) following manufacturer protocol. Total nuclear extract (2.5\u2009\u00b5g) was added to measure PARP activity. For details see Supplementary Table <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#MOESM1\" target=\"_blank\" rel=\"noopener\">2<\/a>.<\/p>\n<p>For measurement of PARylation efficiency, cells were treated with 400\u2009\u00b5M H2O2 for 15 and 30\u2009min or subjected to 20\u2009Gy \u03b3-radiation. At the end of incubation, cells were placed on ice, washed once with PBS, and lysed directly on a plate with 2\u00d7 Laemmli buffer. Samples were boiled for 10\u2009min at 95\u2009\u00b0C and processed by western blot.<\/p>\n<p>Preparation of fluorescent ligands, binding assays and fluorescence polarization measurements<\/p>\n<p>PAR oligomers of different lengths (PAR16, and PAR28) were synthesized, purified, fractionated, and labelled with Alexa Fluor 488 (AF488) dye at the 1\u2033 end, following as described<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 62\" title=\"Dasovich, M. et al. Identifying poly(ADP-ribose)-binding proteins with photoaffinity-based proteomics. J. Am. Chem. Soc. 143, 3037&#x2013;3042 (2021).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR62\" id=\"ref-link-section-d50040955e3289\" target=\"_blank\" rel=\"noopener\">62<\/a>,<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 63\" title=\"Tan, E. S., Krukenberg, K. A. &amp; Mitchison, T. J. Large-scale preparation and characterization of poly(ADP-ribose) and defined length polymers. Anal. Biochem. 428, 126&#x2013;136 (2012).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR63\" id=\"ref-link-section-d50040955e3292\" target=\"_blank\" rel=\"noopener\">63<\/a>.<\/p>\n<p>To investigate the binding of human and bowhead whale CIRBPs to the fluorescently labelled PAR and RNA oligomers, titration experiments were conducted. CIRBP proteins were 4:3 serially diluted and titrated into solutions containing a fixed concentration (3\u2009nM) of the fluorescently labelled PAR. The binding reactions were performed in triplicate in a buffer comprising 50\u2009mM Tris-HCl pH 7.5, 100\u2009mM KCl, 2\u2009mM MgCl2, 10\u2009mM \u03b2-mercaptoethanol, and 0.1\u2009mg\u2009ml\u22121 BSA. The reactions were incubated in dark at room temperature for 30\u2009min in a Corning 384-well Low Flange Black Flat Bottom Polystyrene NBS Microplate (3575).<\/p>\n<p>After incubation, fluorescence polarization measurements were performed on a CLARIOstar Plus Microplate Reader from BMG LABTECH equipped with polarizers and Longpass Dichroic Mirror 504\u2009nm. The excitation wavelength was set at 482\u2009nm with 16\u2009nm bandwidth, and emission was monitored at 530\u2009nm with 40\u2009nm bandwidth. The fluorescence polarization values were measured three times, the means of which were analysed to determine binding affinities. The binding curves were fitted using a nonlinear regression model to determine dissociation constants (KD). The increase in fluorescence polarization was quantified to indicate the hydrodynamic differences upon proteins binding to ligands. Data analysis and curve fitting were performed using GraphPad Prism.<\/p>\n<p>Immunofluorescence<\/p>\n<p>Exponentially growing cells from humans and bowhead whales were cultured on Lab-Tek II Chamber Slides (ThermoFisher Scientific), followed by treatment with bleomycin at a final concentration of 5\u2009\u00b5g\u2009ml\u22121 for 1\u2009h. DNA damage foci were stained with \u03b3H2AX and 53BP1 antibodies and quantified at 1\u2009h, 4\u2009h and 24\u2009h. Considering the potential non-specificity of \u03b3H2AX and 53BP1 antibodies across species, we used co-localized foci as a more reliable indication of DNA damage.<\/p>\n<p>After bleomycin treatment, cells were washed twice in PBS, fixed with 2% formaldehyde for 20\u2009min at room temperature, washed three times in PBS, and incubated in chilled 70% ethanol for 5\u2009min. After three additional washes in PBS, fixed cells were permeabilized with 0.2% Triton X-100 for 15\u2009min at room temperature, washed twice for 15\u2009min in PBS, and blocked in 8% BSA diluted in PBS supplemented with 0.1% Tween-20 (PBS-T) for 2\u2009h at room temperature. Cells were then incubated with mouse monoclonal anti-\u03b3H2AX (Millipore, 05-636, 1:1,000) and rabbit polyclonal anti-53BP1 antibodies (Abcam, ab172580, 1:1,000) diluted in 1% BSA-PBS-T at +4\u2009\u00b0C overnight. After incubation with primary antibodies, cells were washed in PBS-T three times for 10\u2009min and incubated with goat anti-rabbit (Alexa Fluor 488) (Abcam, 1:1500) and goat anti-mouse antibodies (Alexa Fluor 568) (Thermo Fisher Scientific, 1:1,000) for 1\u2009h at room temperature. After four washes for 15\u2009min in PBS-T, slides were mounted in VECTASHIELD Antifade Mounting Medium with DAPI.<\/p>\n<p>For chromatin CIRBP association, cells were pre-incubated with CSK\/CSK\u2009+\u2009R buffer for 3\u2009min at room temperature, washed once in PBS, and subjected to the procedure described above using rabbit monoclonal anti-CIRBP antibodies (Abcam, 1:1,000).<\/p>\n<p>Images were captured using the Nikon Confocal system. Confocal images were collected with a step size of 0.5\u2009\u00b5m covering the depth of the nuclei. Foci were counted manually under 60\u00d7 magnification.<\/p>\n<p>For details see Supplementary Table <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#MOESM1\" target=\"_blank\" rel=\"noopener\">2<\/a>.<\/p>\n<p>Construction of lentiviral overexpression vectors and lentivirus production<\/p>\n<p>The coding sequences of hCIRBP and bwCIRBP were amplified by PCR using Phusion polymerase (NEB), digested with EcoRI and NotI, and cloned between the EcoRI and NotI sites of the Lego-iC2 plasmid. The sequence was verified by Sanger sequencing. Lentiviral particles were produced in Lenti-X 293\u2009T cells (Takara). Approximately 10\u00d7106 cells were transfected with a mixture of pVSV-G (1.7\u2009\u00b5g), psPAX2 (3.4\u2009\u00b5g), and Lego-iC2-bwCIRBP (6.8\u2009\u00b5g) using PEI MAX (Polysciences). The day after transfection, the DMEM culture medium (ThermoFisher) was replaced with fresh medium, and lentiviral particles were collected from the supernatant for the next 3 days. For details see Supplementary Table <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#MOESM1\" target=\"_blank\" rel=\"noopener\">2<\/a>.<\/p>\n<p>Quantification of micronuclei<\/p>\n<p>To analyse binucleated cells containing micronuclei, 10,000\u201320,000 cells were plated per chamber slide before irradiation or I-SceI transfection. Immediately after treatment, cytochalasin B was added to the cell culture media at a final concentration of 0.5\u20131\u2009\u00b5g\u2009ml\u22121, and cells were incubated for an additional 72\u2013120\u2009h. At the end of the incubation period, cells were washed with PBS, incubated in 75\u2009mM KCl for 10\u2009min at room temperature, fixed with ice-cold methanol for 1.5\u20133\u2009min, air-dried, and stored. Immediately before analysis, cells were stained with 100\u2009\u00b5g\u2009ml\u22121 acridine orange for 2\u2009min, washed with PBS, mounted in PBS, and analysed by fluorescence microscopy. Alternatively, cells were mounted in VECTASHIELD Antifade Mounting Medium with DAPI. At least 100 binucleated cells were analysed per sample. For details see Supplementary Table <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#MOESM1\" target=\"_blank\" rel=\"noopener\">2<\/a>.<\/p>\n<p>Chromosomal aberration analysis<\/p>\n<p>Metaphase spreads were prepared according to a standard protocol. In brief, 0.06\u2009\u00b5g\u2009ml\u22121 colchicine (Sigma) was added to the growth medium for 4\u2009h, and cells were collected with a 0.25% solution of trypsin\/EDTA, treated for 10\u2009min with a hypotonic solution (0.075\u2009M KCl\/1% sodium citrate) at 37\u2009\u00b0C, and fixed with three changes of pre-cooled (\u221220\u2009\u00b0C) methanol\/acetic acid mixture (3:1) at \u221220\u2009\u00b0C. Cells were dropped onto pre-cleaned microscope glass slides and air-dried. Metaphase spreads were stained with Giemsa Stain (Sigma) solution in PBS. For each variant, 100 metaphases were analysed. For details see Supplementary Table <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#MOESM1\" target=\"_blank\" rel=\"noopener\">2<\/a>.<\/p>\n<p>Mismatch repair assay<\/p>\n<p>pGEM5Z(+)-EGFP was a gift from L. Sun (Addgene plasmid #65206; <a href=\"http:\/\/n2t.net\/addgene:65206\" target=\"_blank\" rel=\"noopener\">http:\/\/n2t.net\/addgene:65206<\/a>; RRID:<a href=\"https:\/\/scicrunch.org\/resolver\/Addgene_65206\/\" target=\"_blank\" rel=\"noopener\">Addgene_65206<\/a>). p189 was a gift from L. Sun (Addgene plasmid #65207; <a href=\"http:\/\/n2t.net\/addgene:65207\" target=\"_blank\" rel=\"noopener\">http:\/\/n2t.net\/addgene:65207<\/a>; RRID:<a href=\"https:\/\/scicrunch.org\/resolver\/Addgene_65207\/\" target=\"_blank\" rel=\"noopener\">Addgene_65207<\/a>). Preparation of the heteroduplex EGFP plasmid was following a published method<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 64\" title=\"Zhou, B. et al. Preparation of heteroduplex enhanced green fluorescent protein plasmid for in vivo mismatch repair activity assay. Anal. Biochem. 388, 167&#x2013;169 (2009).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR64\" id=\"ref-link-section-d50040955e3412\" target=\"_blank\" rel=\"noopener\">64<\/a>. In brief, pGEM5Z(+)-EGFP plasmid was nicked with Nb.Bpu10I (Thermo Scientific). After phenol\/chloroform extraction and ethanol precipitation, the nicked plasmid was digested with Exonuclease III (Thermo Scientific) for 10\u2009min at 30\u2009\u00b0C. p189 was linearized with restriction enzyme BstXI (NEB) and mixed with the purified circular ssDNA at a ratio of 1.0:1.5 to generate a heteroduplex EGFP plasmid containing a G\/T mismatch and a nick. The heteroduplex EGFP plasmid with high purity was recovered using a DNA cleanup kit.<\/p>\n<p>Exponentially growing cells were transfected using a 4D-nucleofector (Lonza) with the P1 solution using the DS120 program. In a typical reaction, 2\u2009\u00d7\u2009105 cells were transfected with 50\u2009ng of heteroduplex EGFP plasmid along with 50\u2009ng of DsRed2 to serve as a transfection control. After transfection (48\u2009h), cells were collected and analysed by flow cytometry on a CytoFlex S flow cytometer (Beckman Coulter).<\/p>\n<p>For details see Supplementary Table <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#MOESM1\" target=\"_blank\" rel=\"noopener\">2<\/a>.<\/p>\n<p>Host cell reactivation assay<\/p>\n<p>A host cell reactivation assay was employed to assess the repair of UV-induced DNA damage via nucleotide excision repair, following previously described methods<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 26\" title=\"Tian, X. et al. SIRT6 is responsible for more efficient DNA double-strand break repair in long-lived species. Cell 177, 622&#x2013;638.e22 (2019).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR26\" id=\"ref-link-section-d50040955e3435\" target=\"_blank\" rel=\"noopener\">26<\/a>.<\/p>\n<p>To evaluate the repair of oxidative DNA damage (base excision repair), a mixture of 20\u2009\u00b5g of firefly luciferase (FFL) plasmid and 20\u2013200\u2009\u00b5M methylene blue was prepared, with water added to reach a final volume of 0.4\u2009ml. The DNA\u2013methylene blue mixture was dropped onto a petri dish and placed on ice, with another petri dish containing water positioned on top. Subsequently, the DNA\u2013methylene blue mixture was exposed to visible light for 15\u2009min using a 100\u2009W lamp positioned at an 11\u2009cm distance. Damaged DNA was then purified, and the host cell reactivation assay was performed as described for UV-induced DNA damage<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 30\" title=\"Lu, J. Y. et al. Comparative transcriptomics reveals circadian and pluripotency networks as two pillars of longevity regulation. Cell Metab. 34, 836&#x2013;856.e5 (2022).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR30\" id=\"ref-link-section-d50040955e3442\" target=\"_blank\" rel=\"noopener\">30<\/a>. For details see Supplementary Table <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#MOESM1\" target=\"_blank\" rel=\"noopener\">2<\/a>.<\/p>\n<p>Cyclobutane pyrimidine dimer ELISA<\/p>\n<p>Human and bowhead whale skin fibroblasts were cultured until they reached confluency before UVC radiation. Cells were irradiated in PBS at doses of 0, 5, 10, 20 and 30\u2009J\u2009m\u22122 and immediately collected to construct an induction curve. To assess DNA repair, cells were irradiated at 30\u2009J\u2009m\u22122 and then incubated for 6, 24 and 48\u2009h before collecting. Genomic DNA was isolated using the QIAamp Blood Kit (Qiagen). DNA samples were diluted in PBS to a final concentration of 2\u2009\u00b5g\u2009ml\u22121, denatured at 100\u2009\u00b0C for 10\u2009min, and then incubated in an ice bath for 15\u2009min. Next, 100\u2009ng of denatured DNA solution was applied to ELISA plate wells precoated with protamine sulfate (Cosmo Bio) and dried overnight at 37\u2009\u00b0C. Plates were washed five times with PBS supplemented with 0.05% Tween-20 (PBS-T) and then blocked in 2% FBS in PBS-T for 30\u2009min at 37\u2009\u00b0C. After five washes with PBS-T, plates were incubated with mouse monoclonal anti-cyclobutane pyrimidine dimer (CPD) antibodies (Clone TDM-2, 1:1,000) in PBS for 30\u2009min at 37\u2009\u00b0C. Subsequently, plates were sequentially incubated with goat anti-mouse biotin IgG (Invitrogen, 1:1,000) and streptavidin-HRP (Invitrogen, 1:5,000) in PBS for 30\u2009min at 37\u2009\u00b0C each, with five washes with PBS-T before and after each incubation. Plates were then washed with citrate buffer and incubated with a substrate solution (citrate buffer\/o-phenylenediamine\/hydrogen peroxide) for 30\u2009min at 37\u2009\u00b0C. Finally, the reaction was stopped with 2\u2009M H2SO4, and the absorbance was measured at 492\u2009nm using a plate reader. For details see Supplementary Table <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#MOESM1\" target=\"_blank\" rel=\"noopener\">2<\/a>.<\/p>\n<p>CIRBP variant sequence analysis<\/p>\n<p>Identification of rare codons (https:\/\/www.benchling.com\/). CAI was calculated with human codon frequencies using the E-CAI web server<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 35\" title=\"Puigb&#xF2;, P., Bravo, I. G. &amp; Garcia-Vallv&#xE9;, S. E-CAI: a novel server to estimate an expected value of codon adaptation index (eCAI). BMC Bioinformatics 9, 65 (2008).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR35\" id=\"ref-link-section-d50040955e3489\" target=\"_blank\" rel=\"noopener\">35<\/a>.<\/p>\n<p>RNA isolation and RNA-seq analysis<\/p>\n<p>RNA from exponentially growing or senescent mouse, cow, human and bowhead whale primary skin fibroblasts was isolated using the RNeasy Plus Mini Kit (Qiagen) according to manufacturer instructions.<\/p>\n<p>Raw reads were demultiplexed using configurebcl2fastq.pl (v.1.8.4). Adapter sequences and low-quality base calls (threshold: Phred quality score <a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 65\" title=\"Chen, S., Zhou, Y., Chen, Y. &amp; Gu, J. fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 34, i884&#x2013;i890 (2018).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR65\" id=\"ref-link-section-d50040955e3505\" target=\"_blank\" rel=\"noopener\">65<\/a>. For all species, the clean reads were aligned using Salmon (v.1.5.1)<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 66\" title=\"Patro, R., Duggal, G., Love, M. I., Irizarry, R. A. &amp; Kingsford, C. Salmon provides fast and bias-aware quantification of transcript expression. Nat. Methods 14, 417&#x2013;419 (2017).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR66\" id=\"ref-link-section-d50040955e3509\" target=\"_blank\" rel=\"noopener\">66<\/a> to longest coding sequence (CDS) of each gene extracted from corresponding genome assembly based on human-referenced TOGA annotations. The values of read count and effective gene lengths for each gene were collected and integrated into gene sample table according to their orthologous relationship. Salmon transcript counts were used to perform differential expression analysis. Only human genes with orthologues in all species were kept for the downstream species. To filter out low expressed genes, only gene with all sample read counts sum &gt;10 were retained. The filtered count matrix was normalized using median of ratios method<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 67\" title=\"Anders, S. &amp; Huber, W. Differential expression analysis for sequence count data. Genome Biol. 11, R106 (2010).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR67\" id=\"ref-link-section-d50040955e3513\" target=\"_blank\" rel=\"noopener\">67<\/a> implemented in DESeq2 package<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 68\" title=\"Love, M. I., Huber, W. &amp; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15, 550 (2014).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR68\" id=\"ref-link-section-d50040955e3517\" target=\"_blank\" rel=\"noopener\">68<\/a>. The matrix of effective lengths for each gene in each sample was delivered to the DESeq2 \u2018DESeqDataSet\u2019 object to avoid biased comparative quantifications resulting from species-specific transcript length variation. Differential expression analysis was performed using DESeq2 and log transformed fold changes were used for gene set enrichment analysis to assess the differential expression of DNA repair pathways in bowhead whale, cow, and mouse compared to human. Genes of DNA repair pathways were compiled from 3 resources: MsigDB database, gene ontology, and a curated gene list (<a href=\"http:\/\/www.mdanderson.org\/documents\/Labs\/Wood-Laboratory\/human-dna-repair-genes.html\" target=\"_blank\" rel=\"noopener\">www.mdanderson.org\/documents\/Labs\/Wood-Laboratory\/human-dna-repair-genes.html<\/a>)<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 69\" title=\"Lange, S. S., Takata, K. I. &amp; Wood, R. D. DNA polymerases and cancer. Nat. Rev. Cancer 11, 96&#x2013;110 (2011).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR69\" id=\"ref-link-section-d50040955e3529\" target=\"_blank\" rel=\"noopener\">69<\/a>,<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 70\" title=\"Wood, R. D., Mitchell, M. &amp; Lindahl, T. Human DNA repair genes, 2005. Mutat. Res. 577, 275&#x2013;283 (2005).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR70\" id=\"ref-link-section-d50040955e3532\" target=\"_blank\" rel=\"noopener\">70<\/a>.<\/p>\n<p>Nanopore sequencing<\/p>\n<p>Seventy-two hours after transfection, cells were collected and genomic DNA was isolated with the Wizard Genomic DNA Purification Kit (Promega). DNA concentration was measured on a Nanodrop spectrophotometer and 100\u2009ng of DNA per sample was PCR-amplified with Q5 High-Fidelity 2\u00d7 Master Mix (NEB). PCR products were prepared for multiplexed Nanopore sequencing using the Native Barcoding Kit 96 V14 SQK-NBD114.96 (Oxford Nanopore Technologies). Following end prep, barcoding, and adapter ligation, samples were cleaned up using AMPure XP Beads and loaded onto a R10.4.1 flow cell on a MinION Mk1C (Oxford Nanopore Technologies) for sequencing. Raw data was basecalled in Super-High accuracy mode with barcode and adapter trimming enabled, demultiplexed, and aligned to the NHEJ reporter construct reference sequence FASTA in Dorado. A custom Python script was used to parse CIGAR strings from the resulting BAM files and quantify indels.<\/p>\n<p>Genomic DNA extraction and whole-genome sequencing of tumour xenografts<\/p>\n<p>Matching primary cell lines, transformed cell lines, and tumour xenograft samples were prepared as described above. Samples included one mouse cell line, two human cell lines, and two bowhead whale cell lines. One fresh cell pellet was prepared for each primary and transformed cell line. For frozen tumour samples, one tumour for mouse, one tumour for each human cell line (two tumours total), four tumours for whale cell line 14B11SF, and five tumours for whale cell line 18B2SF were included in the analysis. Genomic DNA extraction and whole-genome sequencing were performed as previously described with minor modifications<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 71\" title=\"Perelli, L. et al. Interferon signaling promotes tolerance to chromosomal instability during metastatic evolution in renal cancer. Nat. Cancer 4, 984&#x2013;1000 (2023).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR71\" id=\"ref-link-section-d50040955e3552\" target=\"_blank\" rel=\"noopener\">71<\/a>,<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 72\" title=\"Perelli, L. et al. Evolutionary fingerprints of epithelial-to-mesenchymal transition. Nature 640, 1083&#x2013;1092 (2025).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR72\" id=\"ref-link-section-d50040955e3555\" target=\"_blank\" rel=\"noopener\">72<\/a>. In brief, DNA was extracted from samples using the QIamp DNA Mini Kit, per manufacturer\u2019s recommendations. Isolated genomic DNA was quantified with Qubit 2.0 DNA HS Assay (ThermoFisher) and quality assessed by agarose gel. Library preparation was performed using KAPA Hyper Prep kit (Roche) per manufacturer\u2019s recommendations. gDNA was sheared to approximately 400\u2009bp using Covaris LE220-plus, adapters were ligated, and DNA fragments were amplified with minimal PCR cycles. Library quantity and quality were assessed with Qubit 2.0 DNA HS Assay (ThermoFisher), Tapestation High Sensitivity D1000 Assay (Agilent Technologies), and QuantStudio 5 System (Applied Biosystems). Illumina 8-nt dual-indices were used. Equimolar pooling of libraries was performed based on QC values and sequenced on an Illumina NovaSeq X Plus (Illumina) with a read length configuration of 150 PE for 60\u2009M PE reads (30\u2009M in each direction) per sample.<\/p>\n<p>Bioinformatic analysis of tumour xenograft whole-genome sequencing<\/p>\n<p>The bioinformatic processing pipeline of raw whole-genome high-throughput sequencing data was adapted for human, mouse and bowhead whale data<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 71\" title=\"Perelli, L. et al. Interferon signaling promotes tolerance to chromosomal instability during metastatic evolution in renal cancer. Nat. Cancer 4, 984&#x2013;1000 (2023).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR71\" id=\"ref-link-section-d50040955e3567\" target=\"_blank\" rel=\"noopener\">71<\/a>. Sequencing FastQ files were applied to FastQC (v.0.11.9; <a href=\"https:\/\/www.bioinformatics.babraham.ac.uk\/projects\/fastqc\/\" target=\"_blank\" rel=\"noopener\">https:\/\/www.bioinformatics.babraham.ac.uk\/projects\/fastqc\/<\/a>) for quality control, adapters were trimmed by Trimmomatic (v.0.39)<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 73\" title=\"Bolger, A. M., Lohse, M. &amp; Usadel, B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30, 2114&#x2013;2120 (2014).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR73\" id=\"ref-link-section-d50040955e3578\" target=\"_blank\" rel=\"noopener\">73<\/a>, and the genomic fragments were aligned to the human, mouse and whale genome reference (hg19, mm10 and the published bowhead whale genome assembly<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 13\" title=\"Keane, M. et al. Insights into the evolution of longevity from the bowhead whale genome. Cell Rep. 10, 112&#x2013;122 (2015).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR13\" id=\"ref-link-section-d50040955e3582\" target=\"_blank\" rel=\"noopener\">13<\/a>) using Burrows\u2013Wheeler Aligner (BWA, v.0.7.19)<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 74\" title=\"Li, H. &amp; Durbin, R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 25, 1754&#x2013;1760 (2009).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR74\" id=\"ref-link-section-d50040955e3586\" target=\"_blank\" rel=\"noopener\">74<\/a>, then sorted and indexed by Samtools (v.1.16.1)<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 75\" title=\"Li, H. et al. The Sequence Alignment\/Map format and SAMtools. Bioinformatics 25, 2078 (2009).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR75\" id=\"ref-link-section-d50040955e3591\" target=\"_blank\" rel=\"noopener\">75<\/a>. Somatic mutations were detected from tumour samples using MuTect2 (GATK v.4.2.5.0)<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 76\" title=\"Van der Auwera, G. A. et al. From FastQ data to high confidence variant calls: the Genome Analysis Toolkit best practices pipeline. Curr. Protoc. Bioinformatics 43, 11.10.1&#x2013;11.10.33 (2013).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR76\" id=\"ref-link-section-d50040955e3595\" target=\"_blank\" rel=\"noopener\">76<\/a> to call somatic SNVs and small indels (30\u00d7, normal sample coverage &gt;30\u00d7) and variant allele frequency (VAF)\u2009\u2265\u20090.1. Structural variations were called by Manta (v.1.6.0) applying default settings and SV length\u2009&gt;6,000\u2009bp were used for downstream analysis<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 77\" title=\"Chen, X. et al. Manta: rapid detection of structural variants and indels for germline and cancer sequencing applications. Bioinformatics 32, 1220&#x2013;1222 (2016).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR77\" id=\"ref-link-section-d50040955e3599\" target=\"_blank\" rel=\"noopener\">77<\/a>.<\/p>\n<p>Alkaline comet assay<\/p>\n<p>For the alkaline comet assay, we adapted the alkaline comet assay protocol provided by TREVIGEN based on a published in-gel comet assay method<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 78\" title=\"Nickson, C. M. &amp; Parsons, J. L. Monitoring regulation of DNA repair activities of cultured cells in-gel using the comet assay. Front. Genet. 5, 232 (2014).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR78\" id=\"ref-link-section-d50040955e3611\" target=\"_blank\" rel=\"noopener\">78<\/a> to increase the number of cell lines and time points assessed and minimize assay variation introduced during sample collection and processing. Slides were precoated with a base layer 50\u2009\u00b5l of 1% SeaKem LE Agarose (Lonza) to enhance adhesion. We cultured cells to near 100% confluency and then resuspended them in CometAssay LMAgarose (R&amp;D Systems). We applied 500 cells suspended in 100\u2009\u00b5l LMAgarose onto each slide. The slides were then placed in the dark at 4\u2009\u00b0C for 10\u2009min to allow the agarose to solidify. After that, slides with live cells were incubated in tissue culture incubators in fibroblast culture medium containing 700\u2009\u00b5M freshly diluted H2O2 for 30\u2009min, followed by washing with PBS and incubation for various recovery periods (ranging from 0\u2009min to 12\u2009h) in culture medium. Slides were collected at each time point, washed with PBS, and immersed in CometAssay Lysis Solution (R&amp;D Systems). Before electrophoresis, slides were placed in alkaline unwinding solution prepared according to the TREVIGEN protocol for 10\u2009min. After electrophoresis at 22\u2009V for 30\u2009min, the slides were placed in a DNA precipitation buffer following the TREVIGEN protocol for 10\u2009min and subsequently washed three times with distilled water. The slides were then immersed in 70% ethanol for 10\u2009min and allowed to air dry in the dark. Before imaging, each sample was stained with 50\u2009\u00b5l of 1\u00d7 SYBR Gold (Thermo Fisher Scientific) for 5\u2009min before being washed three times with distilled water. Comet images were acquired through fluorescent microscopy. For scoring, we used profile analysis in OpenComet<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 79\" title=\"Gyori, B. M., Venkatachalam, G., Thiagarajan, P. S., Hsu, D. &amp; Clement, M. V. OpenComet: an automated tool for comet assay image analysis. Redox Biol. 2, 457&#x2013;465 (2014).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR79\" id=\"ref-link-section-d50040955e3619\" target=\"_blank\" rel=\"noopener\">79<\/a> within ImageJ. Outliers automatically flagged by OpenComet were excluded from analysis and remaining incorrectly demarcated comets were further systematically filtered out according to two criteria: a comet area greater than 5,000 or head area greater than 500. For details see Supplementary Table <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#MOESM1\" target=\"_blank\" rel=\"noopener\">2<\/a>.<\/p>\n<p>Tissue processing<\/p>\n<p>Tissues obtained from wild-caught animals were assumed to be of younger\/middle age since predation normally precedes ageing in the wild. Postmortem interval was minimized and, in all cases, samples were kept on ice and frozen in less than 24\u2009h. At the earliest opportunity after dissection, tissues from representative animals from each species were flash frozen in liquid nitrogen and stored at \u221280\u2009\u00b0C. Tissues were pulverized to a fine powder within a Biosafety cabinet under liquid nitrogen using a stainless-steel pulverizer Cell Crusher (Fisher Scientific) chilled in liquid nitrogen and delivered to storage tubes with a scoop that had also been pre-chilled in liquid nitrogen and kept on dry ice. Similarly, when sampled for various omics processing, pulverized tissues were removed with a stainless-steel spatula that was pre-chilled in liquid nitrogen. Samples were never thawed after initial freezing until extractions were performed.<\/p>\n<p>Cross-species tissue proteomics<\/p>\n<p>We employed a shotgun-style untargeted data-dependent acquisition label-free quantitative (LFQ) approach. Approximately 5\u2009mg of tissue was mixed with 250\u2009\u00b5l of 50\u2009mM TEAB pH7.6; 5% SDS, mixed by pipetting, and briefly vortexed. Samples were sonicated in a chilled cup horn Q800R3 Sonicator System (Qsonica) for a total of 15\u2009min at 30% output and duration of 30 \u00d730\u2009s pulses (with 30\u2009s in between pulses) at 6\u2009\u00b0C using a chilled circulating water bath. When nuclear proteomes were analysed, nuclei were first isolated using a hypotonic lysis approach as in the preparation of histones<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 80\" title=\"Shechter, D., Dormann, H. L., Allis, C. D. &amp; Hake, S. B. Extraction, purification and analysis of histones. Nat. Protoc. 2, 1445&#x2013;1457 (2007).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR80\" id=\"ref-link-section-d50040955e3643\" target=\"_blank\" rel=\"noopener\">80<\/a>. Isolated nuclei were lysed and processed as indicated above with SDS and sonication and then handled similarly for the rest of the prep. Samples were heated to 90\u2009\u00b0C for 2\u2009min and allowed to cool to room temperature. Next, samples were centrifuged at 14,000g for 10\u2009min to pellet insoluble debris and the supernatants were transferred to clean tubes. Total protein was quantified by the BCA assay and 100\u2009\u00b5g was reduced with 5\u2009mM dithiothreitol (DTT) for 30\u2009min at 60\u2009\u00b0C. Samples were cooled to room temperature and then alkylated with 10\u2009mM iodoacetamide (from a freshly prepared stock) for 30\u2009min at room temperature in the dark. Samples were processed using the standard S-trap mini column method (Protifi; Farmingdale, NY). Samples were digested with 4\u2009\u03bcg trypsin overnight at 37\u2009\u00b0C. Elution fractions were pooled and dried using a Speedvac (Labconco). Peptides were resuspended in 100\u2009\u03bcl MS-grade water (resistance \u226518M\u03a9) and quantified using the Pierce Quantitative Fluorometric Peptide Assay (Thermo). Common internal Retention Time standards (CiRT) peptide mix was added (50 fmol mix\/2\u2009\u00b5g tryptic peptides) and 2\u2009\u00b5g (in 4\u2009\u00b5l) of tryptic peptides were injected\/analysed by mass spectrometry (MS) on a Orbitrap Tribrid Fusion Lumos instrument (Thermo) equipped with an EASY-Spray HPLC Column (500\u2009mm x 75um 2um 100\u2009A\u2009P\/N ES803A, Nano-Trap Pep Map C18 100\u2009A; Thermo). Buffer A was 0.1% formic acid and buffer B was 100% acetonitrile with 0.1% formic acid. Flow rate was 300\u2009nl\/min and runs were 150\u2009min: 0\u2013120\u2009min, 5% B to 35% B; then from 120\u2013120.5\u2009min, 35\u201380% B; followed by a 9-minute 80% B wash until 130\u2009min. From 130\u2013130.5\u2009min B was decreased to 5% and the column was re-equilibrated for the remaining 20-min at 5% B. the instrument was run in data-dependent analysis mode. MS2 fragmentation was with HCD (30% energy fixed) and dynamic exclusion was operative after a single time and lasted for 30\u2009s. Additional instrument parameters may be found in the Thermo RAW files.<\/p>\n<p>Computational proteomics analysis<\/p>\n<p>Raw files were analysed directly with the MSFragger (v.3.4)\/Philosopher pipeline (v.4.2.1)<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 81\" title=\"da Veiga Leprevost, F. et al. Philosopher: a versatile toolkit for shotgun proteomics data analysis. Nat. Methods 17, 869&#x2013;870 (2020). 2020 17:9.\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR81\" id=\"ref-link-section-d50040955e3658\" target=\"_blank\" rel=\"noopener\">81<\/a>,<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 82\" title=\"Kong, A. T., Leprevost, F. V., Avtonomov, D. M., Mellacheruvu, D. &amp; Nesvizhskii, A. I. MSFragger: ultrafast and comprehensive peptide identification in mass spectrometry&#x2013;based proteomics. Nat. Methods 14, 513&#x2013;520 (2017).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR82\" id=\"ref-link-section-d50040955e3661\" target=\"_blank\" rel=\"noopener\">82<\/a> and included Peptide and Protein Prophet modules<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 83\" title=\"Ma, K., Vitek, O. &amp; Nesvizhskii, A. I. A statistical model-building perspective to identification of MS\/MS spectra with PeptideProphet. BMC Bioinformatics 13, S1 (2012).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR83\" id=\"ref-link-section-d50040955e3665\" target=\"_blank\" rel=\"noopener\">83<\/a> for additional quality control. Quantitation at the level of MS1 was performed with the label-free quant\u2013match between runs (LFQ-MBR) workflow using default parameters. This allows for alignment of chromatographic peaks between separate runs. Methionine oxidation and N-terminal acetylation were set as variable modifications. MaxLFQ with a minimum of two ions was implemented and normalization of intensity across runs was selected<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 84\" title=\"Yu, F., Haynes, S. E. &amp; Nesvizhskii, A. I. IonQuant enables accurate and sensitive label-free quantification with FDR-controlled match-between-runs. Mol. Cell Proteomics 20, 100077 (2021).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR84\" id=\"ref-link-section-d50040955e3669\" target=\"_blank\" rel=\"noopener\">84<\/a>.<\/p>\n<p>LC\u2013MS proteomic analysis of fibroblasts<\/p>\n<p>Two 15-cm dishes of growing primary fibroblasts from 2 cell lines for each species were collected for protein. Cells were washed with PBS and pellets were snap frozen and stored in liquid nitrogen until processing. Cells were solubilized with 5% SDS; 50\u2009mM TEAB pH 7 and sonicated at 8\u2009\u00b0C with 10\u00d7 45\u2009s pulses using 30% power with 15\u2009s rest between each pulse with a cup horn Q800R3 Sonicator System (Qsonica). Soluble proteins were reduced with 10\u2009mM DTT for 30\u2009min at 55\u2009\u00b0C, followed by alkylation with 15\u2009mM iodoacetamide at 25\u2009\u00b0C in the dark for 30\u2009min. S-trap micro columns (Protifi) were employed after this step for overnight tryptic digestion and peptide isolation according to manufacturer instructions. All solvents were MS-grade. Resulting tryptic peptides were resuspended in MS-grade water and were quantified using a Pierce Quantitative Fluorometric Peptide Assay (Thermo Fisher 23290). Prior to MS, peptides were mixed with a common internal retention time standards115 (CiRT) peptide mix (50 fmol CiRT per 2\u2009\u00b5g total tryptic peptides) and acetonitrile and formic acid were added to concentrations of 5% and 0.2% respectively. The final concentration of the peptide mix was 0.5\u2009\u00b5g\u2009\u00b5l\u22121. Two micrograms (4\u2009\u00b5l) of each were resolved by nano-electrospray ionization on an Orbitrap Fusion Lumos MS instrument (Thermo) in positive ion mode. A 30\u2009cm home-made column packed with 1.8 \u03bcm C18 beads was employed to resolve the peptides. Solvent A was 0.1% formic acid and solvent B was 80% acetonitrile with 0.1% formic acid and flow rate was 300\u2009nl\u2009min\u22121. The length of the run was 3\u2009h with a 155\u2009min gradient from 10\u201338% B. HCD (30% collision energy) was used for MS2 fragmentation and dynamic exclusion was operative after a single time and lasted for 30\u2009s. Peptide assignments and quantitation were done using the LFQ-MBR workflow of MSFragger<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" title=\"da Veiga Leprevost, F. et al. Philosopher: a versatile toolkit for shotgun proteomics data analysis. Nat. Methods 17, 869&#x2013;870 (2020). 2020 17:9.\" href=\"#ref-CR81\" id=\"ref-link-section-d50040955e3685\">81<\/a>,<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" title=\"Kong, A. T., Leprevost, F. V., Avtonomov, D. M., Mellacheruvu, D. &amp; Nesvizhskii, A. I. MSFragger: ultrafast and comprehensive peptide identification in mass spectrometry&#x2013;based proteomics. Nat. Methods 14, 513&#x2013;520 (2017).\" href=\"#ref-CR82\" id=\"ref-link-section-d50040955e3685_1\">82<\/a>,<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 83\" title=\"Ma, K., Vitek, O. &amp; Nesvizhskii, A. I. A statistical model-building perspective to identification of MS\/MS spectra with PeptideProphet. BMC Bioinformatics 13, S1 (2012).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR83\" id=\"ref-link-section-d50040955e3688\" target=\"_blank\" rel=\"noopener\">83<\/a>. MaxLFQ with a minimum of two ions was implemented and normalization was selected. Additional details are available in MSFragger log files. Searches were performed within the Philosopher\/Fragpipe pipeline that incorporates PeptideProphet and ProteinProphet filtering steps to increase the likelihood of correct assignments<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 83\" title=\"Ma, K., Vitek, O. &amp; Nesvizhskii, A. I. A statistical model-building perspective to identification of MS\/MS spectra with PeptideProphet. BMC Bioinformatics 13, S1 (2012).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR83\" id=\"ref-link-section-d50040955e3692\" target=\"_blank\" rel=\"noopener\">83<\/a>. The databases used for searches were predicted proteins from the published bowhead genome<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 13\" title=\"Keane, M. et al. Insights into the evolution of longevity from the bowhead whale genome. Cell Rep. 10, 112&#x2013;122 (2015).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR13\" id=\"ref-link-section-d50040955e3696\" target=\"_blank\" rel=\"noopener\">13<\/a> as well as our custom proteome derived from our de novo sequenced and Trinity<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 30\" title=\"Lu, J. Y. et al. Comparative transcriptomics reveals circadian and pluripotency networks as two pillars of longevity regulation. Cell Metab. 34, 836&#x2013;856.e5 (2022).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR30\" id=\"ref-link-section-d50040955e3701\" target=\"_blank\" rel=\"noopener\">30<\/a>,<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 85\" title=\"Haas, B. J. et al. De novo transcript sequence reconstruction from RNA-seq using the Trinity platform for reference generation and analysis. Nat. Protoc. 8, 1494&#x2013;1512 (2013).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR85\" id=\"ref-link-section-d50040955e3704\" target=\"_blank\" rel=\"noopener\">85<\/a>-assembled pool of transcriptomes from whale tissues. Human (UP000005640), mouse (UP000000589), and bovine (UP000009136) databases were from the latest build available from Uniprot<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 86\" title=\"Bateman, A. et al. UniProt: the universal protein knowledgebase in 2021. Nucleic Acids Res. 49, D480&#x2013;D489 (2021).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR86\" id=\"ref-link-section-d50040955e3708\" target=\"_blank\" rel=\"noopener\">86<\/a>. For the searches, databases also included a reverse complement form of all peptides as well as common contaminants to serve as decoys for false discovery rate calculation by the target\/decoy approach (decoy present at 50%). Final false discovery rate was below 1%. To distinguish between non-quantifiable and non-detected proteins in figure displays, proteins detected but below the limit of quantification were imputed to an abundance of 104, and proteins not detected were imputed to an abundance of 0.<\/p>\n<p>Doxycycline-inducible I-SceI NHEJ reporter<\/p>\n<p>The plasmid was assembled from several parts. The backbone was amplified from a pN1 plasmid without f1 bacteriophage origin of replication and modified by the addition of short insulator sequences<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 87\" title=\"Liu, M. et al. Genomic discovery of potent chromatin insulators for human gene therapy. Nat. Biotechnol. 33, 198&#x2013;203 (2015). 2014 33:2.\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR87\" id=\"ref-link-section-d50040955e3722\" target=\"_blank\" rel=\"noopener\">87<\/a> (E2, A2 and A4) purchased from Integrated DNA Technologies. The GFP reporter gene with I-SceI endonuclease sites was amplified from the reporter described above and fused via the P2A self-cleaving peptide with TetOn transactivator, amplified from Lenti-X Tet-One Inducible Expression System Puro (Takara, 631847). A bi-directional promoter sequence featuring hPGK and TRE3GS was amplified from the same plasmid and cloned upstream of the GFP reporter, in the orientation for TetOn-P2A-reporter to be driven by the constitutive hPGK promoter. Downstream of the Tre3GS promoter was closed codon-optimized sequence for intron-encoded endonuclease I (I-SceI) with SV40 nuclear localization sequence (NLS) at the N-terminus and nucleoplasmin NLS at the C-terminus fused to the enhanced blue fluorescent protein (eBFP2) via P2A. The fusion was purchased from Integrated DNA Technologies. EBFP2 sequence was derived from eBFP2-N2 plasmid (Addgene #54595). Cloning was done with In-fusion Snap assembly kit (Takara 638947), NEBuilder HiFi DNA Assembly (NEB, E5520) and T4 DNA ligase (NEB, M0202). The efficiency of NHEJ DSB repair was analysed in immortalized normal human dermal fibroblasts (NHDF2T). The expression cassette containing a GFP reporter gene under hPGK promoter and an I-SceI endonuclease under doxycycline-inducible Tre3GS promoter was inserted into the genome by random integration method. The positive clones were selected by G418 for 10 days and the clones were pooled together. The GFP reporter had a short adeno-exon flanked by two I-SceI recognition sites (in inverted orientation) surrounded by the rat Pem1 intron. Upon stimulation with doxycycline (100\u2009ng\u2009ml\u22121), I-SceI produced two non-ligatable DSBs, resulting in excision of the adeno-exon and reconstitution of the functional GFP.<\/p>\n<p>Fly lines, husbandry and lifespan assays<\/p>\n<p>Virgin daughterless-GeneSwitch (daGS)<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 88\" title=\"Tricoire, H. et al. The steroid hormone receptor EcR finely modulates Drosophila lifespan during adulthood in a sex-specific manner. Mech. Ageing Dev. 130, 547&#x2013;552 (2009).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR88\" id=\"ref-link-section-d50040955e3739\" target=\"_blank\" rel=\"noopener\">88<\/a> female flies were crossed to transgenic male flies harbouring human or whale CIRBP. The human and whale genes were cloned into the pUAStattB plasmid (confirmed by Oxford Nanopore Plasmid sequencing) and injected into the VK1 strain by Genetivision. We then crossed these flies into a ywR background. Sequences of CIRBP were exactly the same as those used for other experiments in this study, apart from a synonymous change in whale where base 303 was changed from G to A to reduce GC content, so that it could be ordered as a whole gBlock.<\/p>\n<p>Crosses were performed in bottles (at 25\u2009\u00b0C in incubators), and offspring were mated for two days, prior to separation of sexes under light CO2 anaesthesia (\u22121). Age-synchronized cohorts were split for each cross into the four treatments (control, 50\u2009\u00b5M, 100\u2009\u00b5M, 200\u2009\u00b5M RU486) each day for lifespan experiments. Diets<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 89\" title=\"McCracken, A. W., Buckle, E. &amp; Simons, M. J. P. The relationship between longevity and diet is genotype dependent and sensitive to desiccation in Drosophila melanogaster. J. Exp. Biol. &#010;                https:\/\/doi.org\/10.1242\/jeb.230185&#010;                &#010;               (2020).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR89\" id=\"ref-link-section-d50040955e3753\" target=\"_blank\" rel=\"noopener\">89<\/a> consisted of 8% yeast, 13% table sugar, 6% cornmeal, 1% agar, and nipagin 0.225% (w\/v) (growing bottles contained an additional 0.4% (v\/v) propanoic acid to reduce bacterial growth). Each media cook was split into four, and an equal volume of ethanol (8.6\u2009ml\u2009l\u22121) was added to each batch in which RU486 was dissolved, to generate 0\u2009\u00b5M (control), 50\u2009\u00b5M (low), 100\u2009\u00b5M (medium) and 200\u2009\u00b5M (high). We used a cross of daGS against ywR as a wild-type control for the effect of RU486, and no effect on lifespan was found, as we and others have found repeatedly before<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 90\" title=\"Hayman, D. J. et al. Expansion of Drosophila haemocytes using a conditional GeneSwitch driver affects larval haemocyte function, but does not modulate adult lifespan or survival after severe infection. J. Exp. Biol. 228, jeb249649 (2025).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR90\" id=\"ref-link-section-d50040955e3763\" target=\"_blank\" rel=\"noopener\">90<\/a>,<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 91\" title=\"Simons, M. J. P., Hartshorne, L., Trooster, S., Thomson, J. &amp; Tatar, M. Age-dependent effects of reduced mTor signalling on life expectancy through distinct physiology. Preprint at bioRxiv &#010;                https:\/\/doi.org\/10.1101\/719096&#010;                &#010;               (2019).\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#ref-CR91\" id=\"ref-link-section-d50040955e3766\" target=\"_blank\" rel=\"noopener\">91<\/a>. Food was stored at 4\u20139\u2009\u00b0C for a maximum of 2 weeks and warmed to room temperature before use.<\/p>\n<p>Lifespan analysis was performed at 25\u2009\u00b0C in a climate controlled room with 50\u201375 female flies per demography cage, with 6\u20137 replicate cages per treatment per cross. Dead flies were counted every other day, with flies stuck to the food or escaped, right-censored. All lifespan data presented was run concurrently at the same time. Data was analysed using mixed-effects coxme models accounting for the effects of cage and transfer day (to correct for shared environmental effects). In separate experiments, but ran around the same time, and following the same procedure as above, we exposed flies to a lethal dose of X-ray (650\u2009Gy) using RX-650 X-radiator System (Faxitron). This data was analysed using coxph. All treatments were irradiated within the same batches, whilst housed in a 2\u2009ml eppendorf in groups of a maximum of 20. Female flies were irradiated at age 17 days and remaining lifespan was measured in the cage setup as described above.<\/p>\n<p>Statistical analyses<\/p>\n<p>Statistical comparisons were performed as indicated in the figure legends. Unless otherwise specified in the text or legend, n refers to separate biological replicate cell lines, isolated from different individuals for a given species. Exceptions include specific genetically modified cell lines or clones, for example, tumour suppressor knockout lines. In such cases, n refers to technical replicates and indicates the number of times the experiment was repeated with the specified cell line. Details for comparisons done by ANOVA are included in Supplementary Table <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#MOESM1\" target=\"_blank\" rel=\"noopener\">1<\/a>.<\/p>\n<p>Reporting summary<\/p>\n<p>Further information on research design is available in the\u00a0<a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-025-09694-5#MOESM2\" target=\"_blank\" rel=\"noopener\">Nature Portfolio Reporting Summary<\/a> linked to this article.<\/p>\n","protected":false},"excerpt":{"rendered":"Reagents Detailed information on reagents, such as antibodies and sequences of primers, probes, CRISPR guides, and siRNAs, is&hellip;\n","protected":false},"author":3,"featured_media":342092,"comment_status":"","ping_status":"","sticky":false,"template":"","format":"standard","meta":{"footnotes":""},"categories":[8],"tags":[102486,168418,10046,10047,168419,159,168420,67,132,68],"class_list":{"0":"post-342091","1":"post","2":"type-post","3":"status-publish","4":"format-standard","5":"has-post-thumbnail","7":"category-science","8":"tag-cancer-models","9":"tag-double-strand-dna-breaks","10":"tag-humanities-and-social-sciences","11":"tag-multidisciplinary","12":"tag-non-homologous-end-joining","13":"tag-science","14":"tag-senescence","15":"tag-united-states","16":"tag-unitedstates","17":"tag-us"},"share_on_mastodon":{"url":"https:\/\/pubeurope.com\/@us\/115460670941847438","error":""},"_links":{"self":[{"href":"https:\/\/www.europesays.com\/us\/wp-json\/wp\/v2\/posts\/342091","targetHints":{"allow":["GET"]}}],"collection":[{"href":"https:\/\/www.europesays.com\/us\/wp-json\/wp\/v2\/posts"}],"about":[{"href":"https:\/\/www.europesays.com\/us\/wp-json\/wp\/v2\/types\/post"}],"author":[{"embeddable":true,"href":"https:\/\/www.europesays.com\/us\/wp-json\/wp\/v2\/users\/3"}],"replies":[{"embeddable":true,"href":"https:\/\/www.europesays.com\/us\/wp-json\/wp\/v2\/comments?post=342091"}],"version-history":[{"count":0,"href":"https:\/\/www.europesays.com\/us\/wp-json\/wp\/v2\/posts\/342091\/revisions"}],"wp:featuredmedia":[{"embeddable":true,"href":"https:\/\/www.europesays.com\/us\/wp-json\/wp\/v2\/media\/342092"}],"wp:attachment":[{"href":"https:\/\/www.europesays.com\/us\/wp-json\/wp\/v2\/media?parent=342091"}],"wp:term":[{"taxonomy":"category","embeddable":true,"href":"https:\/\/www.europesays.com\/us\/wp-json\/wp\/v2\/categories?post=342091"},{"taxonomy":"post_tag","embeddable":true,"href":"https:\/\/www.europesays.com\/us\/wp-json\/wp\/v2\/tags?post=342091"}],"curies":[{"name":"wp","href":"https:\/\/api.w.org\/{rel}","templated":true}]}}