Fungal pathogen isolates and host plants<\/p>\n
Maintenance of M.\u2009oryzae and medium composition are as described previously38<\/a>. The M.\u2009oryzae wild-type strain Guy11 isolate was grown on complete medium in a growth chamber at 25\u2009\u00b0C in a 12-h light\u201312-h dark photoperiod for 10\u2009days before conidia were collected for inoculation of rice plants. Mycelial growth of M.\u2009oryzae strains in different stress conditions was measured on complete agar medium supplemented with or without chemicals for 10\u2009days. The chemicals included 5\u2009mM H2O2, which was supplemented to induce oxidative stress; 200\u2009\u03bcg\u2009ml\u22121 congo red or calcofluor white, which was used to induce cell wall stress; and 0.01% SDS, which was used to induce cell membrane stress.<\/p>\n Rice infection with M.\u2009oryzae was conducted as previously described37<\/a>. Conidial suspensions (1\u2009\u00d7\u2009105\u2009spores\u2009ml\u22121) of M.\u2009oryzae strains were used to inoculate rice and incubated for 5\u20137\u2009days before being photographed. The relative fungal DNA amount was calculated using the threshold cycle value (CT) of M.\u2009oryzae POT2 DNA (MoPOT2) against CT of rice ubiquitin genomic DNA39<\/a>. The infection-related development of M.\u2009oryzae was examined following previous reports40<\/a> at indicated hpi with M.\u2009oryzae strains. The frequency of plant penetration was assessed by counting the formation of appressoria and\/or penetration pegs on leaf sheaths of TP309 rice japonica cultivar or its transgenic lines from at least 50 spores in triplicate on an Axio Imager A2 microscope (Zeiss). For infection-related time-course analyses, hpi denotes hours after inoculation with M.\u2009oryzae strains.<\/p>\n R.\u2009solani AG1 strain was grown on potato dextrose agar plates at 28\u2009\u00b0C before mycelia were collected for inoculation according to previous reports41<\/a>. The wild-type F.\u2009graminearum PH-1 strain was routinely cultured on potato dextrose agar plates at 25\u2009\u00b0C. Construction of F.\u2009graminearum deletion mutants and infection assays with wheat seedlings and spikes were conducted following previous reports42<\/a>. The rice TP309 cultivar was inoculated with M.\u2009oryzae and R.\u2009solani, whereas wheat Nanmai 660 cultivar was inoculated with F.\u2009graminearum.<\/p>\n DNA and RNA manipulation<\/p>\n DNA was extracted from samples of fungus or plant using standard cetyltrimethylammonium bromide method according to a previous report43<\/a>. RNA isolation was conducted as described previously39<\/a>. In brief, samples were ground into powder with liquid nitrogen and transferred to 2-ml RNase-free tubes (approximately 100\u2009mg per tube). TRIzol (Invitrogen; 15596026CN) reagent was then used for total RNA extraction according to the manufacturer\u2019s instructions. Total RNA of M.\u2009oryzae was extracted from samples of vegetative mycelia grown in liquid complete medium or minimal medium, conidiophore on complete medium, appressorium and invasive hypha colonizing leaves. Reverse transcription was conducted with the extracted total RNA using the HiScript III RT SuperMix for qPCR (plus gDNA wiper) kit (Vazyme; R323-01), followed by RT\u2013qPCR amplification with the ChamQ SYBR Color qPCR Master Mix kit (Vazyme; Q411) on a NextGene QL96 instrument (Jie Lai Mei Technology). Specific procedures were conducted according to the manufacturer\u2019s instructions.<\/p>\n RNA-seq analysis of M. oryzae<\/p>\n The M.\u2009oryzae wild-type Guy11 strain was allowed to grow under four different conditions before extraction of fungal total RNA using an RNeasy Plant Mini Kit (QIAGEN; 74904). Vegetative mycelia of M.\u2009oryzae were sampled from Guy11 grown in liquid complete medium for 48\u2009h; conidia were sampled from Guy11 grown on complete agar medium for 10\u2009days; the appressoria were sampled from Guy11 undergoing infection structure development on hydrophobic borosilicate glass coverslips (Thermo Fisher Scientific; 12-541-B); invasive hyphae were sampled from Guy11 that has infected rice leaf sheaths for 4\u2009days. Two biological replicate samples were prepared for each growth condition. RNA-seq library construction and sequencing analysis were conducted as previously described39<\/a>. Differentially expressed genes were identified on the basis of an adjusted P value\u2009<\u20090.05 using the DESeq R package44<\/a>.<\/p>\n Generation of M. oryzae mutants<\/p>\n A PCR-based split-marker deletion method was used for targeted gene deletion of lnc117761 as previously described39<\/a>. A 600-bp DNA region of lnc117761 was targeted for replacement by the selection marker gene HPT, which confers resistance to hygromycin B (Roche; 10843555001). For genetic complementation analysis, the lnc117761 full-length gene expression vector containing its native promoter was constructed in a plasmid containing bialaphos resistance selection marker gene BAR, using a ClonExpress II One Step Cloning Kit (Vazyme; C112). To examine the non-coding property of lnc117761, a complementation plasmid was constructed that contains an lnc117761 variant with the potential short open reading frame in lnc117761 disrupted by shift mutation using the PCR-based point mutation method. Using a similar PCR-based mutation method, another variant of lnc117761 complementation plasmid was generated to disrupt the 16\u2009nt of lnc117761 that base-pair with rice miR5827. PCR-based point mutation was also performed to introduce single-nucleotide replacement in MBS of lnc117761 to produce different lnc117761 variants. The resulting lnc117761 constructs carrying nucleotide mutations were separately transformed into \u0394lnc117761 for functional complementation analysis (Supplementary Fig. 1<\/a>). Supplementary Table 8<\/a> details the information for all primers, PCR templates and amplicons.<\/p>\n Generation of transgenic rice lines<\/p>\n A\u00a0CRISPR\u2013Cas9 construction method was used to produce rice lines with miR5827 disrupted (Supplementary Fig. 2<\/a>). Two 23-nt oligonucleotides (including a protospacer-adjacent motif) targeting the OsmiR5827 precursor near its 5\u2032 and 3\u2032 ends were chosen to delete most of the precursor, and the specificity of the targeting sequences was confirmed by a BLAST search against the rice genome (https:\/\/blast.ncbi.nlm.nih.gov\/Blast.cgi<\/a>). Construction of the plasmid and Agrobacterium tumefaciens-mediated transformation of rice were performed according to a previous report37<\/a>. Genomic DNA samples were isolated from transgenic rice lines following the standard cetyltrimethylammonium bromide method43<\/a> and then were used for PCR amplification to confirm the targeted deletion of miR5827-encoding DNA region by sequencing analysis with primer pairs flanking the designed target site. The rice transgenic lines were analysed by PCR to detect the CRISPR\u2013Cas9 construct, and those harbouring edited sequence in the miR5827-encoding DNA region but without the CRISPR\u2013Cas9 insertion in genome were used for phenotypic analyses. The oligonucleotide sequences chosen as guide RNA were listed in Supplementary Table 8<\/a>.<\/p>\n Rice lines with PKR1 disrupted were also generated through CRISPR\u2013Cas9 method using a 23-nt oligonucleotide as guide RNA. To produce rice transgenic lines PKR1KO\u2013compl.PKR1mMBS, a PKR1 mutant construct was generated by site-directed mutagenesis in vector expressing full-length wild-type PKR1. MBS (GGTAGTGCTAAATTGTAACGCA) in wild-type PKR1 was changed to a mutant sequence (TTCCACGTTCCCCCTTCCTGCC) to abolish the miR5827-targeting site in PKR1. The PKR1 mutant construct was subsequently introduced into a PKR1KO rice line through A.\u2009tumefaciens-mediated transformation.<\/p>\n To overexpress M.\u2009oryzae lnc117761 in rice, lnc117761 complementary DNA (cDNA) under control of the 35S promoter of the cauliflower mosaic virus (CaMV 35S) was cloned to binary vector pCAMBIA1300 (Cambia), which contains the HPT selection marker gene. A variant of lnc117761 overexpression plasmid was similarly generated in pCAMBIA1300 to disrupt the 16\u2009nt that base-pair with rice miR5827. The resulting plasmids were separately introduced into rice by A.\u2009tumefaciens-mediated transformation. Rice grain length, grain width and 1,000-grain weight were measured using a Mini 1600 automatic analysis system (Jie Lai Mei Technology).<\/p>\n Analysis of plant miRNA and gene expression levels<\/p>\n In the analysis of miRNA level, total RNA was extracted from different plant samples, including leaf and stem tissues from barley (H.\u2009vulgare), A.\u2009thaliana, potato (S.\u2009tuberosum), B.\u2009distachyon and wheat (T.\u2009aestivum). In brief, the plants were grown in a growth chamber at 25\u2009\u00b0C for approximately 30\u2009days before collecting their respective tissues. For each sample, 100\u2009mg of fresh tissue was ground into powder with liquid nitrogen, transferred to a 2-ml RNase-free tube and then processed for total RNA extraction using TRIzol (Invitrogen; 15596026CN). Total RNA was reverse transcribed using miRNA-specific stem-loop reverse transcription primers (Supplementary Table 8<\/a>) with the miRNA 1st Strand cDNA Synthesis Kit (Vazyme; MR101). The reverse transcription products were subsequently used as a template for qPCR by using miRNA-specific forward primers and the universal reverse primer in miRNA Universal SYBR qPCR Master Mix (Vazyme; MQ101). The U6 RNA served as an internal reference for the detection of miRNAs.<\/p>\n For measuring gene expression, RT\u2013qPCR was performed with the HiScript III RT SuperMix for qPCR (+gDNA wiper) kit (Vazyme; R323-01) and ChamQ SYBR Color qPCR Master Mix kit (Vazyme; Q411). The UBIQUITIN gene (Os03g13170) was used as an internal reference for normalization of gene expression in rice. The potential target genes of miR5827 in rice were determined by psRNATarget tool, and the target genes predicted with high fidelity were selected for confirmation by RT\u2013qPCR analysis with rice total RNA. Following the Minimum Information for Publication of Quantitative Real-Time PCR Experiments standards reported previously45<\/a>, the specificity of primers was examined by BLAST-searching against the plant genome to ensure primer matching to a specific genome locus and by monitoring the melting curve of the RT\u2013qPCR product to ensure a single amplification fragment through single-peak dissociation profiles. Each RT\u2013qPCR assay was repeated with at least two more biological replicates independently with three technical replicates per sample. The 2\u2212\u2206\u2206CT method was used to calculate the relative expression levels with three technical replicates.<\/p>\n In situ hybridization assay<\/p>\n In situ hybridization of lnc117761 distribution pattern was conducted following standard protocols as described previously46<\/a>,47<\/a> with minor modifications. Rice leaf sheaths were collected from TP309 cultivar grown for 4\u2009weeks in a growth chamber and then used for inoculation with or without M.\u2009oryzae Guy11 at a conidial suspension of 2\u2009\u00d7\u2009105\u2009spores\u2009ml\u22121. Thirty hours after infection in a high-humidity environment at 25\u2009\u00b0C, infected rice leaf sheaths were processed for microscopic analysis as described previously48<\/a>. After successful infection with M.\u2009oryzae was confirmed and appressoria and invasive hyphae had developed, the infected rice sheaths were collected and sectioned for fixation with FAA (50% ethyl alcohol, 5% glacial acetic acid and 3.7% formaldehyde) and embedded in wax. Paraffin sectioning was conducted on a microtome (Thermo Fisher Scientific; HM325) to produce 8-\u03bcm paraffin sections, which were processed with standard in situ hybridization protocols49<\/a>.<\/p>\n For better comparison, sectioned samples from the same rice sheath were used for detection with probes targeting lnc117761 and control RNA separately using an ISH Detection Kit (Boster Biological Technology; MK1030). lnc117761-targeting probes (5\u2032-biotin-UAUCUAAAUCGCCGACUGUCAGGUUCCUUGCCGU and 5\u2032-biotin-CAAGUAGUUUUGAUUGCUGUGAGGACACUGCUGC) were synthesized by Sangon Biotech (Supplementary Table 8<\/a>). As a negative control, a neighbouring section derived from the same rice sheath tissue was hybridized to control probes (5\u2032-biotin-UUGUCCCAAGCAGCAGUGUCCUCACAGCAAUCA and 5\u2032-biotin-AUGUUACCCGCCGUUUGAGCAGCACGACCUUU) that target non-transported mRNAs of two control genes (MGG_14955 and MGG_09330, respectively). Meanwhile, an uninfected control sample was included by using rice leaf sheaths without M.\u2009oryzae inoculation for hybridization with the same probes. After overnight hybridization at 42\u2009\u00b0C, washing and blocking, the section slides were incubated with HRP-labelled streptavidin (Beyotime Biotechnology; A0305) at 37\u2009\u00b0C for 30\u2009min. Finally, DAB Horseradish Peroxidase Color Development Kit (Servicebio; G1212) was used to develop brown colour showing the hybridized RNA; meanwhile, blue colouration of cell walls was conducted by haematoxylin counterstaining. Images were captured on Pannoramic scanner (3DHISTECH Pannoramic MIDI II).<\/p>\n Detection of lnc117761 secretion<\/p>\n We used different approaches to investigate lnc117761 trafficking from M.\u2009oryzae to rice. In the first approach, rice leaves at and surrounding the infection site were separately sampled for RT\u2013qPCR analysis to assess lnc117761 distribution within rice tissues following a previous report50<\/a> with minor revisions. We reasoned that if lnc117761 is delivered to infected host cells, it could be transported to surrounding cells, and its presence could be detected by RT\u2013qPCR in neighbouring rice cells before the appearance of fungal cells. In brief, a Guy11 strain constitutively expressing GFP was used to infect detached rice leaves by punch inoculation as previously described51<\/a>. Three different concentrations (4\u2009\u00d7\u2009104\u2009spores\u2009ml\u22121, 2\u2009\u00d7\u2009105\u2009spores\u2009ml\u22121 and 1\u2009\u00d7\u2009106\u2009spores\u2009ml\u22121) of M.\u2009oryzae spore suspension were used separately to inoculate rice cells. After infection, the infected rice leaves were observed at different time points under a fluorescence microscope to separately collect infected samples (sample 1) from infection sites that contained M.\u2009oryzae invasive hyphae and from surrounding tissues (sample 2) that contained no M.\u2009oryzae. Thus, sample 1 contains infected rice cells and close neighbouring uninfected cells, whereas sample 2 contains relatively distal surrounding rice cells to avoid M.\u2009oryzae contamination. The collected rice leaf segments were then used for extraction of total RNA using TRIzol reagent. RT\u2013qPCR was subsequently performed as described above with the rice UBIQUITIN gene as the endogenous control.<\/p>\n In the second approach, extracellular vesicles of M.\u2009oryzae were prepared to assess lnc117761 distribution. In brief, spore suspension of wild-type M.\u2009oryzae Guy11 and \u0394lnc117761 mutant (2\u2009\u00d7\u2009105\u2009spores\u2009ml\u22121) was inoculated into liquid complete medium to allow growth for 48\u2009h. Mycelia were collected, washed with distilled water and transferred to minimal liquid medium supplemented with ground powder of rice leaves. Following 24\u2009h of growth at 25\u2009\u00b0C and 120 revolutions per minute, the culture was centrifuged at 10,000g for 10\u2009min at 4\u2009\u00b0C to collect the supernatant after removing fungal mycelia and rice leaf debris. Extracellular vesicles were then separately isolated from the supernatant of mycelial culture following a previously reported protocol52<\/a>. Supernatant was filtered through a 0.45-\u03bcm membrane filter. The filtrate was centrifuged again at 10,000g for 10\u2009min at 4\u2009\u00b0C. The supernatant was then subjected to ultracentrifugation at 100,000g for 1\u2009h at 4\u2009\u00b0C. The supernatant was discarded, and the vesicle pellet was resuspended in 200\u2009\u03bcl of diethyl pyrocarbonate (DEPC)-treated water. Total RNA was extracted from the prepared vesicles and analysed by RT\u2013qPCR as described above.<\/p>\n In the third approach, GFP-expressing \u0394lnc117761 strain was transformed with an lnc117761\u20134\u00d7Pepper fusion construct, in which 4\u00d7Pepper encodes an RNA motif capable of binding to and activating fluorescent dye Pepper620 (ref.\u200927<\/a>). This strain expressing lnc117761\u20134\u00d7Pepper was used to inoculate rice leaf sheaths, and then the sheaths were stained with fluorescent dye Pepper620 (Fluorescence Diagnosis Shanghai Biotech Company; HBC620) before microscopic analysis. The epifluorescent analysis was conducted with Olympus BX53, UPlanSApo 100 \u00d7\/1.40 oil objective (Olympus) and laser intensity controlled by a VSAOTF100 System and coupled into the light path using a VS-20 Laser-Lens-System (Visitron Systems). Excitation\u00a0and\u00a0emission wavelengths were 488\u2009nm\u00a0and\u00a0520\u2009nm for GFP, and 575\u2009nm\u00a0and\u00a0625\u2009nm for Pepper620. Images were recorded using a charged-coupled device camera (Photometrics CoolSNAP HQ2; Roper Scientific).<\/p>\n Analyses of extracellular vesicles<\/p>\n According to the Minimal Information for Studies of Extracellular Vesicles guidelines53<\/a>, isolated extracellular vesicles of M.\u2009oryzae were examined and validated by transmission electron microscopy, lipophilic dye staining and nanoparticle tracking analysis. A 20-\u03bcl aliquot of the sample was applied onto a specimen holder. For transmission electron microscopy analysis, a copper grid with its formvar\u2013carbon-coated side facing down was placed onto the surface of the droplet containing isolated extracellular vesicles for 3\u2009min. The grid was then removed and allowed to air-dry at room temperature. Subsequently, the grid was placed (coated side down) onto a droplet of 2% phosphotungstic acid solution for negative staining for 2\u2009min. The grid was removed, and excess stain was carefully blotted away using filter paper. The prepared grid was finally examined on a transmission electron microscope (JEOL; JEM-1400FLASH) to observe the vesicles.<\/p>\n For lipophilic dye staining, a sample containing extracellular vesicles was supplemented with 5\u2009\u03bcM of PKH26 red fluorescent dye (Umibio; UR52302), followed by vortex mixing for 1\u2009min and incubation for 10\u2009min. An appropriate volume of 1\u00d7 phosphate-buffered saline (PBS) was then added to the mixture of extracellular vesicle and dye. Labelled extracellular vesicles were reisolated following the standard extraction protocol to remove unbound dye. The pellet was resuspended in 200\u2009\u03bcl of 1\u00d7 PBS, yielding the fluorescently labelled extracellular vesicles that were observed under a Leica confocal microscope using 551-nm excitation for fluorescence imaging. For nanoparticle tracking analysis, a sample containing isolated extracellular vesicles was sonicated for 15\u2009s (frequency of 20\u2009kHz; 30% of 150-W power; 5-s pulse on\u20135-s pulse off; repeated three times) to disperse aggregated particles and then diluted to an appropriate concentration with PBS before loading for measurement using a NanoSight NS300 nanoparticle tracking analyser.<\/p>\n GFP reporter assay for miR5827 binding with lnc117761 or PKR1<\/p>\n A previously described GFP reporter assay54<\/a>,55<\/a> was used to examine the binding of miR5827 with lnc117761 or PKR1. The expression plasmids were constructed in the pCAMBIA1300 binary vector and introduced into Agrobacterium strain GV3101, with its culture resuspended with the\u00a0infiltration buffer (1\u2009M MgCl2, 200\u2009mM acetosyringone and 0.2\u2009M 2-morpholinoethanesulfonic acid) to a final concentration of OD600 at 0.5. The Agrobacterium suspension was mixed with two combinations as indicated and then placed at room temperature under dark conditions for 3\u2009h. For analysis of miR5827 binding with lnc117761, the 35S-MBSlnc117761\u2013GFP and 35S-mMBSlnc117761\u2013GFP reporter constructs were separately transiently expressed alone or co-expressed with 35S-miR5827 in N.\u2009benthamiana leaves through Agrobacterium at the indicated concentrations (0.1\u20130.6\u2009 optical density). For analysis of miR5827 binding with PKR1, the 35S-MBSPKR1\u2013GFP and 35S-mMBSPKR1\u2013GFP reporter constructs were separately transiently expressed alone or co-expressed with 35S-miR5827 in N.\u2009benthamiana leaves as described above. The two combined Agrobacterium suspensions were subsequently co-injected into fresh leaves of tobacco N.\u2009benthamiana grown for 45\u2009days. Leaves were examined between 36\u2009hpi and 48\u2009hpi for image acquisition using a Leica confocal laser scanning microscope. Immunoblot analyses were performed following standard protocols. In brief, 15\u2009\u03bcg of the total protein was electrophoresed in a 10% SDS\u2013PAGE gel, and the protein blot was probed with anti-GFP (BBI Life Sciences; D191040) diluted 5,000-fold, followed by HRP-conjugated mouse secondary antibody (Invitrogen; 31430) diluted 10,000-fold, to detect and determine GFP accumulation.<\/p>\n ITC assay<\/p>\n ITC was performed at 25\u2009\u00b0C with a NANO ITC instrument (TA Instruments) following standard procedures. Single-stranded miR5827, sense-strand RNA transcripts of lnc117761 and PKR1, as well as their different mutants at the miR5827-binding site (mMBSlnc117761 and mMBSPKR1), were biochemically synthesized by Sangon Biotech. All biochemically synthesized RNA samples were diluted in DEPC-treated water. Subsequently, 75\u2009\u00b5M miR5827 was titrated against 5\u2009\u00b5M of lnc117761 RNA (MBSlnc117761) or 5\u2009\u00b5M of PKR1 RNA (MBSPKR1). Similar experiments were performed with 5\u2009\u00b5M mMBSlnc117761 and 5\u2009\u00b5M mMBSPKR1, respectively, under identical conditions. Binding dissociation constants (Kd) were determined from the integrated injection heats using NanoAnalyze software (TA Instruments) with an independent binding model.<\/p>\n Ligation of interacting RNA and RT\u2013PCR<\/p>\n To assess the interaction between lnc117761 and miR5827, LIGR coupled to RT\u2013PCR experiment was performed following established protocols26<\/a> with minor modifications. Rice TP309 seedings grown in a growth chamber for 2\u2009weeks were inoculated with Guy11 spore suspension prepared in 0.1% Tween-20 at a concentration of 5\u2009\u00d7\u2009105\u2009spores\u2009ml\u22121. After 30\u2009h of inoculation, infected rice leaves were collected for total RNA extraction with TRIzol reagent. Meanwhile, total RNA samples extracted from mock-inoculated (0.1% Tween-20) TP309 leaves and from M.\u2009oryzae hyphae were separately used as control RNA. For crosslinking, 50\u2009\u03bcg of each total RNA was supplemented with 20\u2009mg\u2009ml\u22121 of 4\u2032-aminomethyl-4,5\u2032,8-trimethylpsoralen (AMT) (MCE; HY-138287) together with ice-cold Tris\u2013saline buffer (0.15\u2009M NaCl and 0.01\u2009M Tris\u2013HCl; pH\u20097.2) to a final volume of 40\u2009\u03bcl containing 20\u2009\u03bcg\u2009ml\u22121 of AMT. The mixture was then irradiated with 365-nm light in an Ultraviolet Crosslinker equipment (Analytik Jena; CL-1000M) for 30\u2009min on ice to crosslink the RNA hybrids containing miR5827 and lnc117761. The crosslinked RNA mixture was next processed for circularization using T4 RNA Ligase 1 (New England Biolabs; M0204) according to the manufacturer\u2019s instructions, followed by lithium chloride (Invitrogen; AM9480) precipitation to purify RNA.<\/p>\n The crosslinked, circularized RNA was enriched by digestion with RNase R (Beyotime; R7092S), which specifically hydrolyses linear RNA. Following this, circular RNA was isolated through lithium chloride precipitation and resuspended in 20\u2009\u00b5l of Tris\u2013saline buffer. For crosslink reversal, the precipitated RNA was irradiated for 5-min intervals for 10\u2009min at 254\u2009nm on ice. RNA samples were processed by ethanol precipitation to remove AMT and used as reverse transcription template to synthesize first-strand cDNA with miR5827-specific primer by SuperScript III First-Strand Synthesis System (Invitrogen; 18080-051). The cDNA product was amplified with primer pair LIGR-F1 and LIGR-R (Supplementary Table 8<\/a>) in the first round PCR, and then with inner primer pair LIGR-F2 and LIGR-R in the second round nested PCR. The PCR product was sequenced to detect the hybrid RNA formed from miR5827 and lnc117761 as a result of their binding.<\/p>\n RNA pull-down analysis for binding between lnc117761 and miR5827<\/p>\n The single-stranded RNA transcripts of full-length lnc117761, mut-lnc117761 carrying mutation in the miR5827 binding site and GFP control were obtained by in vitro transcription with HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs; E2050S) using 1\u2009\u03bcg of each cDNA transcription template produced by PCR amplification with primer pairs listed in Supplementary Table 8<\/a>. RNA products were purified with Monarch RNA Cleanup Kits (New England Biolabs; T2040), and purified RNA was then labelled with biotin using the Pierce RNA 3\u2032 End Desthiobiotinylation Kit (Thermo Fisher Scientific; 20163) according to the manufacturer\u2019s instructions. An amount of 50\u2009pmol of biotin-labelled RNA transcripts of lnc117761, mut-lnc117761 and GFP was individually added into 50\u2009\u00b5l of streptavidin magnetic beads from the Pierce Magnetic RNA-Protein Pull-Down Kit (Thermo Fisher Scientific; 20164) and incubated at 25\u2009\u00b0C for 30\u2009min, followed by magnetic purification and washing on a DynaMag-Spin (Invitrogen; 12320D). In the subsequent RNA pull-down procedure, biochemically synthesized 21-nt miR5827 RNA (Sangon Biotech), dispersed in a mixture of RNA binding buffer, was added to magnetic beads bound with biotin-labelled RNA. After incubation at 4\u2009\u00b0C for 60\u2009min with rotation, the mixture in magnetic beads was washed three times on DynaMag-Spin. RNA binding products were finally eluted in 50\u2009\u03bcl of elution buffer at 37\u2009\u00b0C for 30\u2009min.<\/p>\n To detect miR5827 enriched by lnc117761 from the above RNA pull-down assay, first-strand cDNA of miR5827 was reverse transcribed using the SuperScript III First-Strand Synthesis System with a primer specific for miR5827. PCR was then performed to amplify the miR5827 target fragment, which was separated by 1.5% agarose gel electrophoresis and stained. Meanwhile, digital PCR was conducted to quantify the amounts of miR5827 obtained from the RNA pull-down assay using a nanoplate-based QIAcuity Digital PCR System (QIAcuity One 5-Plex). In a 12-\u03bcl digital\u00a0PCR mixture, 1\u2009\u03bcl of diluted cDNA was used as template and mixed with 0.48-\u03bcl primer pairs and 4\u2009\u03bcl of QIAcuity EvaGreen Master Mix (QIAcuity EG PCR; 2500113). The mixture was loaded into a QIAcuity Nanoplate 8.5k 24-well PCR nanoplate (QIAGEN; 250012) and subsequently subjected to reaction under the program of the QIAcuity Digital PCR System. Finally, partitioning and data analysis were performed through QIAcuity software v.2.2.0.26.<\/p>\n Dual-luciferase reporter assay<\/p>\n For the dual-luciferase reporter assay, the DNA sequences of MBSlnc117761, mMBSlnc117761, MBSPKR1 and mMBSPKR1 were separately cloned upstream of the firefly luciferase gene in the pGreenII 62-SK vector. The recombinant pGreenII 62-SK and pCAMBIA1300-35S\u2013miR5827 constructs were co-transfected into rice protoplasts. At 24\u2009h post-transfection, luminescence of rice protoplasts was measured using the Dual Luciferase Reporter Assay Kit (Beyotime; RG027). The relative LUC\/REN ratio was calculated from luminescence readings. Detailed procedures for luminescence measurement followed the manufacturer\u2019s protocol.<\/p>\n EMSA<\/p>\n EMSA was conducted following a previous report56<\/a> using the Chemiluminescent EMSA Kit (Beyotime; GS606). RNA oligonucleotides (MBSlnc117761, mMBSlnc117761, MBSPKR1 and mMBSPKR1) and biotin-labelled miR5827 (with biotin conjugated to the 5\u2032 end of the oligo) were synthesized by Sangon Biotech with the following sequences: 5\u2032GGUAACCAUCCUUGGAGACCUUCGUCGCAGUUGCAACAAACAUCUAUGGGAUGCUUAUCU3\u2032 for MBSlnc117761, 5\u2032GGUAACCAUCCUUGGAGACCUGCGCCGCAGCUCACUACCUCAUCUAUGGGAUGCUUAUCU3\u2032 for mMBSlnc117761, 5\u2032AGAAAAGGAAUGUAAGCUGGGUAGUGCUAAAUUGUAACGCAUUUUUUCAAUAACCAAUUG3\u2032 for MBSPKR1, 5\u2032AGAAAAGGAAUGUAAGCUGUUCCACGUUCCCCCUUCCUGCCUUUUUUCAAUAACCAAUUG3\u2032 for mMBSPKR1 and biotin-5\u2032UUUGUUGCAAUUUGGACUACC3\u2032 for miR5827. RNA oligonucleotide sequences of point mutant MBSPKR1 (M1-MBSPKR1 to M20-MBSPKR1) and point mutant MBSlnc117761 (M1-MBSlnc117761 to M16-MBSlnc117761) carrying targeted replacement at single nucleotide in their MBS are listed in Supplementary Table 8<\/a>. Detailed EMSA procedures were performed according to the manufacturer\u2019s instructions. Images were captured using a charge-coupled device camera on Touch Imager (e-Blot Life Science). ImageJ was used to quantify the intensity of each band obtained by EMSA.<\/p>\n Uptake of external small RNA by T. aestivum root and coleoptile<\/p>\n Fluorescein-labelled TamiR5827 (FAM-TamiR5827) was synthesized by Sangon Biotech. Coleoptiles and roots were collected from wheat seedlings grown on water agar medium for 5\u2009days. The tissues were immersed in a solution of 100\u2009ng\u2009\u00b5l\u22121 of FAM-TamiR5827, with DEPC-treated water serving as a negative control. After 6\u2009h of incubation, half of coleoptiles and roots were transferred to the 50\u2009U\u2009\u00b5l\u22121 of Micrococcal Nuclease enzyme buffer (Thermo Fisher Scientific; 88216), whereas the remaining samples were moved to DEPC-treated water at 37\u2009\u00b0C for 30\u2009min. Temporary sections were then prepared using freehand sectioning for fluorescence microscopic analysis. In parallel, this assay was performed in T.\u2009aestivum protoplasts isolated using the Wheat Protoplast Preparation and Transformation Kit (Coolaber; PPT121).<\/p>\n Sequence analysis of DNA region encoding RNAs similar to miR5827 from different species<\/p>\n The 21-nt mature rice miR5827 sequence derived from the DNA region in rice and a 31-nt sequence where miR5827 is located were used as BLAST search queries against the Ensembl database to identify homologous sequences in the genomes of representative microorganisms and plants. The 31-nt length was selected to include both the 21-nt core-binding site of miR5827 and 5\u2009nt of the flanking sequence on each side, allowing assessment of both the essential binding region and its immediate structural context. The query sequence was aligned to the downloaded genomes using BLAST v.2.12. BLAST search strategy was specifically designed to avoid sampling bias. For each of the two groups (microorganisms and plants), we retained only the single best-matched sequence per species, ensuring that the resulting multiple sequence alignments shown in Supplementary Table 6<\/a> reflect the diversity of the sequence motif across kingdoms rather than the abundance within any single genome. The sequence logo was constructed on the basis of the alignment of relevant sequences representing the level of nucleotide occurrence in each position using WebLogo 3 analysis30<\/a>, which reflects the presence of a similar sequence motif across diverse species. Despite the short sequence, the resulting sequence logos reflect the sequence similarity across diverse species.<\/p>\n Software and algorithms<\/p>\n The software and algorithms used are all publicly accessible. ZEN 2012 imaging software blue edition (Carl Zeiss Microscopy) was used to track and collect the micrographs. Image Lab v.3.0 build 11 (Bio-Rad) was used for DNA electrophoresis and immunoblot data collection. Long non-coding RNA was predicted using Coding Potential Calculator 2, available at https:\/\/cpc2.gao-lab.org\/<\/a>. GraphPad Prism is available at https:\/\/www.graphpad.com\/<\/a>. ImageJ is available at https:\/\/imagej.net\/ij\/<\/a>. The miRNA database used is miRbase at https:\/\/www.mirbase.org<\/a>.<\/p>\n Quantification and statistical analysis<\/p>\n To quantify the statistical significance of differences, the probability value (P value) was determined with two-sided Student\u2019s t-test or analysis of variance (ANOVA) using the Microsoft Excel software. No statistical method was used to predetermine the sample size. The sample size was chosen according to common practice in the research field.\u00a0The data collection was not blinded because when conducting the experiments, we had to be aware of controls and treated groups. The samples were\u00a0randomly selected for statistic analysis.\u00a0All values are presented as mean\u2009\u00b1\u2009s.d. All experiments were repeated at least twice, except where otherwise indicated, to confirm reliability.<\/p>\n Availability of materials<\/p>\n Constructs, transgenic seeds and strains generated in this study are available upon request, but a completed material transfer agreement may be required.<\/p>\n Reporting summary<\/p>\n